AU619303B2 - Creación de Inventos y Patentes con Inteligencia Artificial

AU619303B2 – Novel cdna cloning vectors
– Google Patents

AU619303B2 – Novel cdna cloning vectors
– Google Patents
Novel cdna cloning vectors

Download PDF
Info

Publication number
AU619303B2

AU619303B2
AU36313/89A
AU3631389A
AU619303B2
AU 619303 B2
AU619303 B2
AU 619303B2
AU 36313/89 A
AU36313/89 A
AU 36313/89A
AU 3631389 A
AU3631389 A
AU 3631389A
AU 619303 B2
AU619303 B2
AU 619303B2
Authority
AU
Australia
Prior art keywords
cdna
recombinant dna
dna
dna molecule
pcdpolyb
Prior art date
1988-06-14
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)

Ceased

Application number
AU36313/89A
Other versions

AU3631389A
(en

Inventor
Steven C. Pruitt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)

Health Research Inc

Original Assignee
Health Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
1988-06-14
Filing date
1989-06-14
Publication date
1992-01-23

1989-06-14
Application filed by Health Research Inc
filed
Critical
Health Research Inc

1990-02-01
Publication of AU3631389A
publication
Critical
patent/AU3631389A/en

1992-01-23
Application granted
granted
Critical

1992-01-23
Publication of AU619303B2
publication
Critical
patent/AU619303B2/en

2009-06-14
Anticipated expiration
legal-status
Critical

Status
Ceased
legal-status
Critical
Current

Links

Espacenet

Global Dossier

Discuss

Classifications

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09—Recombinant DNA-technology

C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09—Recombinant DNA-technology

C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA

C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09—Recombinant DNA-technology

C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

C12N15/70—Vectors or expression systems specially adapted for E. coli

Description

r -s 619303 COMMONWEALTH OF AUSTRALIA PATENTS ACT 1952 COMPLETE SPECIFICATION NAME ADDRESS OF APPLICANT: Health Research Inc.
666 Elm Street Buffalo New York United States of America NAME(S) OF INVENTOR(S): 0 OS S 0
S
Steven C. PRUITT (4 0 C* a **00 o* 0 ADDRESS FOR SERVICE: DAVIES COLLISON Patent Attorey, 1 Little Collins Street, Melbourne, 3000.
COMPLETE SPECIFICATION FOR THE INVENTION ENTITLED: Novel cDNA cloning vectors The following statement is a full description of this invention, including the best method of performing it known to me/us:-
_L
1
I
4
V
7 -la- The present invention is directed to recombinant DNA vector molecules and uses therefor. More particularly, the present invention relates to the construction of recombinant vectors useful in the high frequency cloning of cDNA. The present invention also relates to vectors capable of directing the synthesis of single stranded cDNA and thereby permitting enrichment of specific sequences by hybridization/selection.
Techniques applicable to the generation of 0 complementary DNA (cDNA) to specific messenger RNA (mRNA) provide an important mechanism by which the structure, organization and expression of genetic material in eukaryotic cells can be analyzed. More particularly, the mechanism enables the identification, isolation and characterization of specific genes resident in chromosomal DNA. One generalized method by which cDNA can be synthesized is the contacting of a heterogenous mixture of mRNA to reverse transcriptase to generate cDNA:mRNA hybrid S. molecules. The RNA strands are removed from the hybrids by heat denaturation or by RNase H treatment and the second cDNA strand is synthesized using DNA polymerase (Klenow fragment) and S1 nuclease treatment. The resulting hetergeneous. mixture of double stranded cDNA molecules can then be cloned using a variety of techniques into recombinant DNA vector molecules.
In an alternative approach, mRNA molecules are first annealed to vector DNA. Okayama and Berg I (Mol.
Cell. Biol. 2: 161-170, 1982), and incorporated herein by reference, have described such a strategy for cloning full 30 Slength, or nearly full length, cDNA molecules in Escherichia coli. This cloning strategy is predicated on
‘I
ALl 2linking an oligo (dT) primer to a linearized vector to Sgenerate a vector primer and the annealing poly mRNA to the oligo (dT) primer. A cDNA strand is synthesized complementary to the annealed mRNA template and the strand terminated with an oligo (dC) linker. The resulting linear molecule is cleaved with the restriction endonuclease Hind I III to yield a molecule unable to circularize either by annealing or by ligation due to the presence of incompatible ends. Consequently, circularization is accomplished by the intermolecular ligation of a linker DNA segment comprising a Hind III generated terminus and a oligo (dG) tailed terminus which allows the abridgement of the vector primer Hind III terminus with the oligo (dC) terminated cDNA:mRNA. In this procedure, the RNA strand is replaced by DNA following treatment with RNase H, DNA 15 polymerase and DNA ligase. Okayama and Berg II (Mol. Cell.
Biol. 3: 280-289, 1983), and incorporated herein by reference, subsequently described a cloning vector system based on the aforementioned cloning strategy that permits expression of cDNA in mammalian cells. This vector system 20 comprises pcDV1, a recombinant molecule containing a DNA sequence from pBR322 and two segments from Simian Virus including the poly A region. Using this system, pcDVl is restricted with the .nzyme Kpn 1 and ligated to an oligo (dT) linker to generate the vector primer. mRNA is 25 then annealed and the cDNA synthesized as described above.
i The oligo (dC) tailed linker segment required for re-circularization and which contains the SV40 origin of replication, is derived from plasmid pL1. The recombinant cDNA molecule is thus capable of replication in both E.
30 coli and SV40-sensitive mammalian cells.
-3- By employing the general principles of the SOkayama and Berg procedure, alternative strategies for cDNA cloning have been developed. Nakamura, et al. (Gene, 44: 347-351, 1986) developed an expression vector useful in immunological screening of desired recombinant molecules.
In this system, expression of cloned cDNA is directed by tandem lac control regions derived from pUC8 and pUC19.
Carrington and Morris (Virology 139: 22-32, 1984) cloned a portion of the Carnation Mottle virus germ using DNA fragments derived from pVC8 and pBR322 instead of the SpBR322-SV40 hybrid plasmid described by Okayama and Berg.
In another procedure, Coleclough and Erlitz (Gene 34: 305-314, 1985) described the use of primer-restriction-end (PRE) adapters in a cDNA cloning strategy. In this procedure, cDNA is synthesized using a PRE adapter as a 15 S. primer oligonucleotide. One end of the cDNA strand is S annealed to a vector by oligo (dC) and (dG) pairing. The Sother end is ligated by the addition of another PRE adapter.
Although the high efficiency of incorporation of 20 2 full length cDNA obtained using the Okayama and Berg protocol is a substantial advantage, this protocol has not been employed in many studies due to the relatively low efficiency with which transformants are obtained per i microgram of starting vector and polyadenylated RNA, 25 relative to the use of bacteriophage vectors and the i difficulties associated with screening bacterial colonies, relative to bacteriophage plaques,.using hybridization probes. The present invention describes recombinant DNA vector molecules which allow the efficient cloning of full 0 length cDNA using a modification of the method of Okayama and Berg. The vectors described herein are also useful in the enrichment of specific sequences directly from cDNA libraries by hybridization/selection.
r j 2 The present invention is directed to recombinant DNA mc a) s capable of replication in prokaryotic hosts, and optionally eukaryotic hosts, useful in the high frequency cloning of double-stranded cDNA and in the generation of single stranded cDNA therefrom.
More particularly, one aspect of the present invention relates to recombinant DNA molecules comprising: 0 9 0 00 0 a prokaryotic origin of replication; a selectable marker; a deoxyribonucleic acid sequence permitting synthesis of said recombinant DNA molecule in a single-stranded form; and a unique restriction endonuclease site permitting i) a re-circularization of the linear form of said recombinant DNA molecule containing cDNA by intramolecular ligation; and ii) priming of second strand cDNA synthesis.
Even more particularly, the recombinant DNA contemplated by the present invention comprise: a prokaryotic origin of replication derived from pBR322; an ampicillin resistance encoding gene; the intergenic region of bacteriophage Fl; molecules 09*0 0 00 9 and, a unique BstXI restriction endonuclease S* site.
Another aspect of the present invention relates to said recombinant DNA molecules further comprising a eukaryotic origin of replication and a eukaryotic promoter.
L
j Still another aspect of the present invention Srelates to the use of the intergenic region of bacteriophage Fl in said recombinant DNA molecules to generate single-stranded DNA molecules thereof and which are utilized in nucleic acid hybridization/selection.
The following terms are used in the specification i and claims: Annealing: cDNA: *9 9 9 S
S
9 9 9* 9 9 .9 9 9 9 Hybridization: To hybridize nucleic acid molecules by pairing of A-T or G-C, e.g., an oligo (dG) tail annealing to an oligo (dC) tail.
Complementary DNA. DNA which is complementary to a specific sequence of mRNA.
The formation of stable duplexes between complementary nucleotide sequences via base pairing (A-T, DNA–DNA, DNA-RNA or RNA-RNA hybrids can be formed.
Circularization of a linear DNA molecule by ligation of two ends is referred to as an intra-molecular ligation. Inter-molecular ligation refers to circularization by abridging the two ends with a second segment of DNA.
Inter-, Intramolecular ligation: 09 9999 mRNA: Messenger RNA.
1 -6- Oligo (dC): Oligo (dG) Oligo (dT): 4i .4 i 4 0 0 0 0 0**0 0
S
S
0 S 00 Poly Restriction endonuclease digestion: Vector, plasmid, recombinant .DNA molecule: Short length of deoxycytidine molecules which can be added to the 3′ end of DNA.
Short length of deoxyguanosine molecules which can be added to the 3′ end of DNA.
Short length of deoxythymidine molecules which can be added to the 3′ end of DNA.
The tail of adenylic acid residues which is added to the 3’ end of many eukaryotic mRNA molecules following transcription.
Cleavage of double stranded DNA by a specific enzyme which recognizes a specific sequence of nucleotide bases.
DNA molecules in which non-contiguous sequences have been placed next to each other by in vitro manipulations. In general, the term applies to a DNA molecule, usually derived from a plaemid or bacteriophage, into which fragments of DNA may be inserted or cloned. A plasmid vector replicates autonomously in the cell.
_i I I
I
‘4i:i ji i i f f Ii An expression vector is one in which fragments of DNA to be inserted are placed «downstream» of a promoter and, hence, their coding sequence is transcribed and translated.
o. r* 4 J S
C
a .4 .4
S
55 Library: A collection of recombinant DNA molecules carrying DNA inserts from the genome of an organism. As used herein, the libraries comprise cDNA 0 inserts.
Figure 1 is a diagrammatic representation depicting the construction of pcDpolyB+ and pcDpolyB-.
Figure 2 is a diagrammatic representation depicting the construction of a cDNA clone in pcDpolyB-.
Figure 3 is a photographic representation showing the efficient incorporation of near full-length HPRT and alpha-fetoprotein cDNA into BSB+ and pcDpolyB- libraries.
Figure 4 is a photographic representation showing the isolation of single-stranded circular cDNA library sequences.
Figure 5 is a photographic representation of HPRT cDNA clones obtained by hybridization/selection.
Figure 6 is a photographic representation showing the inefficient digestion of RNA-DNA hybrids by BstXI.
The present invention is directed to recombinant DNA molecules capable of replication in prokaryotic hosts, and optionally, in eukaryotic hosts, useful in the high frequency cloning of double-stranded cDNA and in the generation of single-stranded cDNA therefrom. The 30 recombinant molecules contemplated herein comprise a prokaryotic selectable marker resistance to an
S.
J
PF
5IL.4SI 5 -8antibiotic) a prokaryotic origin of replication SColE1 replication system of pBR322), the intergenic region of bacteriophage Fl, and a unique restriction site BstXI) permitting an intramolecular ligation following the synthesis of at least one cDNA strand. These recombinant molecules optionally comprise a eukaryotic origin of replication from SV40) and eukaryotic regulatory signal sequences poly A, splice and early promoter sequences). As used in the specification and claims herein, a recombinant molecules has the same meaning as a plasmid and a vector and is defined to include circular DNA molecules capable of autonomous replication relative to chromosomal DNA in prokaryotic hosts and optionally in eukaryotic hosts. One skilled in the art will immediately recognize that the recombinant molecules 5 considered herein can be varied with respect to origins of replication, selectable markers and unique restriction sites. The subject recombinant molecules are described using components, which, up to the present time, represent oo the best mode of performing the subject invention. This is 20 done with the understanding that all such variations as will be apparent to the artisan are encompassed by the present invention. Additionally, selectable markers as used herein,, refer to the marker and to the nucleic acid encoding said marker. Selectable markers contemplated by 25 the present invention include resistance to antibiotics such as ampicillin, tetracycline, chloramphenicol, kanamycin, neomycin, rifampicin, carbenicillin, streptomycin and the like. Said selectable markers also i, encompass resistance to phage infection, sensitivity to streptomycin and enzymes which effect colorometric changes.
ooo -9- The subject invention is described using ampicillin as the 1 selectable marker which, up to the present time, represents the best marker available. This is done with the understanding that all such selectable markers are encompassed by the present invention.
Okayama and Berg, I and II, supra, have described a strategy for cloning cDNAs in E. coli which yields full length, or nearly full length, cDNA. Although the high efficiency of incorporation of full length cDNA obtained using the Okayama and Berg protocol is a substantial Sadvantage, this protocol has not been employed in many studies due to the relatively low efficiency with which transformants are obtained per ug of starting vector and polyadenylated RNA, relative to the use of bacteriophage Svectors and the difficulties associated with screening .1 1 15 bacterial colonies, relative to bacteriophage plaques, I using hybridization probes. Two modifications in the original Okayama and Berg method are described herein which overcome these problems. First, to improve the efficiency ~of synthesis of transformation competent cDNA-vector 20 0 molecules, the Okayama and Berg method has been modified V where the important difference is that the original method requires an intermolecular ligation step to recircularize cDNA contairj.ng plasmids and prime second strand cDNA synthesis whereas the scheme described here takes advantage 2 of a BstXI site to create a 3′ oligo (dG) protruding end and thereby allowing the same steps to be accomplished via S* an intra-molecular ligation (See Fig. Second, the plasmids described herein are recoverable in the form of i circular single stranded DNA due to the presence of the 30 intergenic region of bacteriophage Fl. Dotto, et al.
(Virology 114: 463-473, 1983; J. Mol. Biol. 153: 169-176, 1981) first observed that insertion of the intergenic region of the phage Fl genome, which contains all of the cis acting elements required for DNA replication and Smorphogenesis, into the Eco R1 site of pBR322 allowed the packaging and excretion into the culture medium of the pBR322 DNA on superinfection with Fl phage. Additionally, the size of the plasmids which carry the Fl intergenic region is not limited (Dente, et. al. Nuc. Acid. Res. 11: 1645-1655, 1983). The presence of the Fl phage intergenic region in the cDNA cloning vectors described herein allows the recovery of cDNA libraries constructed in these vectors in the form of circular single stranded DNA which are then enriched for specific sequences by hybridization/selection.
The selected circular cDNA is then utilized to transform a suitable bacterial host, facilitating the isolation of specific cDNA. The modifications described herein maintain the advantage of the original Okayama and Berg procedure in 15 cloning full length cDNA with high efficiency and facilitate use of the procedure for a number of applications.
Construction of the vectors pcDpolyB- and BSB+ ee enhances the efficiency with which cDNA is incorporated 20 2 into libraries compared to the method of Okayama and Berg I and II, supra. In the original latter method, a plasmid (either pBR322-SV40 [0.11-0.86] or pcDVl) is opened at the Kpn 1 site and oligo (dT) tailed. The oligo (dT) tail distal to the site at which the RNA will be hybridized is 25 removed by restriction digestion with a second enzyme and the vector fragment is isolated. Polyadenylated RNA is then hybridized to the remaining oligo (dT) tail of the plasmid and copied using reverse transciptase. An oligo (dC) tail is then added to the 3’ end of the cDNA using 30 terminal deoxynucleotidyl transferase and the plasmid is S* digested with the restriction endonuclease Hind III. The resulting molecule can then be recircularized by ligation 1 -11to a second DNA fragment, isolated from a second plasmid (either pBR32-SV40 [0.19-0.32] or pLl), which has been prepared such that it contains a Hind III cohesive protruding end on one terminus of the molecule and an oligo (dG) tail on the other. Hybridization of the oligo (dG) tail from the second fragment to the oligo (dC) synthesis which is accomplished using RNase H and DNA polymerase 1.
A significant improvement over the Okayama and Berg method and described here (Fig. 2) is that, once the first strand of ‘he cDNA is synthesized and oligo (dC) tailed, the oligo (dG) tail required for priming second strand cDNA synthesis and recircularization of the plasmid is provided by digestion of the plasmid with the restriction enzyme BstXI.
SThe recognition sequence for BstXI is CCANNNNN’NTGG, wherein the plasmids pcDpolyB+, pcDpolyB-, BSB+, and .15 BSB- (See Example 2) the sequence is CAAGGGGG’GTTG.
Digestion of each of these plasmids with BstXI then results in a (dG) 4 3’ protruding end which can be utilized I to recircularize the plasmid and to prime second strand cDNA synthesis when hybridized to the oligo (dC) tail 20 0present on the cDNA. One of the main advantages of this approach is that, unlike the original Okayama and Berg method which requires an intermolecular ligation for recircularization, the vectors of the subject invention are i recirculated by an intramolecular ligation between the 25 2 oligo (dC) tail of the cDNA and the oligo (dG) 4 tail d provided by BstXI digestion. In addition to simplifying the steps required for construction of cDNA libraries, this Sdifference enhances the efficiency with which circular I plasmids competent for transformation are generated.
S*
‘A
II- 1
I
I1 -12- 9 The efficiency with which full length cDNA is incorporated into cDNA libraries using the original Okayama and Berg procedure has been studied for several sequences including alpha- and beta-globin and HPRT. The frequency of full-length cDNA clones, relative to the total number of clones containing a portion of these sequences, has been estimated to range between in the case of HPRT, to in the case of the globins. Additionally, in the case of the globins the frequency with which cDNA containing the entire region are generated is at least 30-50%. The high frequency of incorporation of full-length cDNA in libraries constructed using the Okayama and Berg protocol has been attributed to: the use of the vector itself as the primer for both first and second strand cDNA synthesis, 2) the lack of a requirement for treatment of the completed DNA with nucleases prior to insertion into the vector, and 3) the low efficiency with which terminal deoxynucleotidyl transferase utilizes the recessed 3′ ends which would result from incomplete first strand synthesis.
The use of the BstXI site present in each of the vectors pcDpolyB+, pcDpolyB-, BSB+ and BSB- to generate an oligo (dG) 3′ protruding ends for use in recircularization of the cDNA containing plasmids by intramolecular ligation and primiug second strand cDNA synthesis as described herein is designed to maintain the features of the Okayama and Berq procedure which lead to a high frequency of incorporation of full- length cDNA. To determine the efficiency with which near full-length cDNA are incorporated into libraries constructed using the BstXI cloning procedure, the lengths of cDNA containing two specific sequences, HPRT and alpha- fetoprotein are estimated by digestion of library DNA with a restriction 9
L
-13endonuclease, electrophoresis on an agarose gel and detection of either HPRT or alpha-fetoprotein sequences by 32 hybridization to p labeled probes. The length of the HPRT message is 1.55 kbp including 3′ poly- adenylation.
Additionally, a cDNA containing full length HPRT coding sequence has been isolated using the Okayama and Berg technique and is 1.35 kbp long, in reasonable agreement with the length of the 1.55 kb polyadenylated mRNA. At least half of the cDNA homologous to the HPRT probe detected in library B constructed using the vector BSB+ are 1.35 kbp approximately 50 bp and contain the full-length coding sequence of this message. Similarly, the expected length of the alpha-fetoprotein message as determined in previous studies is 2.2 kbp and again, over half of the cDNA homologous to the alpha-fetoprotein probe, 15 S’ present in a -econd library which is constructed using the vector pcDpolB-, is migrated at the position expected for full length cDNA. Accordingly, the BstXI cloning procedure yields a high efficiency of incorporation of full 2 0 length cDNA.
20 The synthesis of circular cDNA containing plasmids, which are competent for transformation, by the Okayama and Berg procedure requires an intermolecular ligation step in which an oligo dC tailed cDNA present on one end of a plasmid is joined to a Hind III protruding end 25 on the distal terminus of the plasmid using a bridging a, fragment which contains an oligo dG tail on one end and a Hind III protruding end on the other. The efficiency which this step occurs is influenced by both the ratio Sbetween the cDNA containing plasmid and the bridging 30 fragment as well as the concentration of the two DNA S -14molecules. The reaction is further complicated by the presence of the DNA fragment containing and Hind III protruding end and an oligo dC tail which results from digestion of the oligo dC tailed cDNA-vector plasmid with Hind III. To increase the efficiency with which cDNA Scontaining plasmids are circularized, a BstXI site is incorporated into each of the cloning vectors described herein. The recognition sequence for BstXI is CCANNNNN’NTGG, where the sequence utilized here is CCAGGGGG’GTGG. Digestion of this sequence with BstXI created a 3′ (dG) 4 protruding end which substitutes for the bridging fragment required iii the Okayama and Berg protocol. This modification eliminates the need for an intermolecular ligation since recircularization of the plasmid can now be accomplished by an intramolecular 15 S. ligation between the oligo (dC) tailed cDNA and the oligo (dG) 4 tail created by BstXI digestion. This modification results in a higher ligation efficiency and consequently more efficient incorporation of cDNA-plasmids into libraries. The number of independent transformants/ug of 20 •DNA obtained using the BstXI method in accordance with the subject invention ranged from about 2.0 to .bout 8.1 X 106 which the Okayama and Berg protocol yields between 0.5 and X 10 independent transformant /ug. As described herein the efficiency of transformation of supercoiled pBR322 DNA is approximately 8.0 X 10 /ug, thus as many as 1/10 of the cDNA plasmid molecules generated using the BstXI protocol of the present invention are competent for transformation.
S.With respect to the foregoing, the incorporation L 30 0 of a BstXI site is, up to the present time, most useful in practicing the subject invention. The skilled artisan will 7 2 recognize that many restriction sites may be alternatively incorporated provided that said sites are unique to the vector. All such sites are accordingly encompassed within the scope of the present invention. The scope of the present invention also encompasses recm-binant DNA Smolecules having the identifying characteristics of BSB+, BSB-, pcDpolyB+ and pcDpolyB- and which individually further comprise a first cDNA strand, and optionally, a second cDNA strand. When said recombinant DNA molecules contain SV40-derived DNA, said molecules are capable of expressing cDNA by vitrue of the early promoter contained therein.
The present invention also relates to a process for enriching a cDNA library in a first recombinant DNA molecule for specific nucleic acid sequences comprising 15 S’ annealing single-stranded forms of cDNA containing said first recombinant DNA molecules to single-stranded forms of a second recombinant DNA molecule containing the nucleic acid sequence to be enriched with the proviso that the S first and second recombinant DNA molecules have the 20 intergenic region from bacteriophage F1 inserted in opposite orientations relative to each other. As defined herein, a cDNA library refers to cDNA ligated into the p ,recombinant .DNA molecules BSB+, BSB-, pcDpolyB+ or i pcDpolyB-. Accordingly, the first and second recombinant DNA molecules are respectively selected from the group consisting of pcDpolyB- and BSB+, pcDpolyB+ and BSB-, BSB- and pcDpolyB+, BSB+ and pcDpolyB-. More particulaly, specific cDNA sequences are isolated from libraries constructed in each of the vectors BSB+ or BSB- 0* 30 and pcDpolyB+ or pcDpolyB- by hybridization/selection.
30 and pcDpolyB+ or pcDpolyB- by hybridization/selection.
-16- This is possible since the presence of the intergenic 1 region from the bacteriophage Fl allows these plasmids to be encapsulated and isolated as single-stranded circular molecules on super-infection with phage Fl or its’ derivatives. The single stranded circular DNA is utilized Sin nucleic acid hybridization reactions and remains I competent for subsequent transformation into bacteria. In this study, by way of example, the isolation of HPRT containing cDNA from a library constructed in pcDpolyB- is demonstrated. Two rounds of hybridization selection are 0 utilized and over half of the cDNA present in the second round sublibrary contain the HPRT gene. Additionally, all of the major species which are present in the original library are represented in the sublibraries.
There are a variety of applications for which the i 15 recovery of specific cDNA sequences by hybridization/ Sselection is useful. First, identification of a specific cDNA sequence using a purified homologous probe, as i demonstrated for HPRT herein, is greatly simplified and is accomplished much more rapidly than is possible using *S S* 0 bacteriophage vectors and plaque hybridization techniques.
1 6 An entire library of 2 X 10 or more independently derived cDNA sequences is screened using about 50 ul hybridization reactions and a sublibrary containing all of the cDNA homologous to a given probe which are present in the 25 original library is accomplished in less than a week. The most complete cDNA which is present is then selected from e the sublibrary directly by size selecting the DNA. The ability to physically separate cDNA containing clones which are homologous to a specific sequence of DNA is valuable in 30 indentifying the individual members of related families of genes since sublibraries of cDNA can be prepared by performing the hybridization step at varying stringencies.
-L
-17- Another significant advantage of the present invention is the ability to select specific cDNA sequences from a cDNA library in the purification of cDNA which is specific to particular cell types or growth stages. It is known that by inverting the orientation of the insertions present in two different cDNA libraries constructed in phagemid vectors it is possible to obtain single stranded DNA in which the opposite strands of sequences common to the two libraries are synthesized and will hybridize while the same strand of the vector from each library is synthesized and consequently does not anneal. Two different cDNA libraries constructed in either the vectors pcDpolyB+ and BSB+ or pcDpolyB- and BSB- are utilized for subtraction of sequences common to the libraries by 1 hybridization selection since the inserts in each of these 15 vector pairs are oriented oppositely. If the single stranded DNA from one of the two libraries is bound to a I sepharose matrix as demonstrated herein for specific probe sequences, then it is possible to physically isolate 1 sublibraries of sequences which are highly enriched for 20 I 2 cDNA sequences present in one of two libraries. This approach facilitates isolation of sequences specific to particular cell types since, although current technologies j using screening techniques are capable of the isolation of a sample of the messages specific to a particular cell 2 type, the necessity to carry each individual sequence I identified through multiple rounds of purification limits i o the number of sequences which are identified using bacteriophage vectors to a relatively small number. Using the vectors described herein, it is now possible to create 30 e sublibraries of sequences which contain many or most of the messages specific to particular cell types by hybridization selection.
A
-18cDNA libraries constructed in the expression 1vectors pcDpolyB+ or pcDpolyB- and which have been enriched for sequences present in a specific cell type greatly facilitate attempts to identify specific cDNA sequences on the basis of the function they express in mammalian cells. A previous attempt to identify a plasmid V containing the HPRT sequence from a cDNA library constructed in the vector pcDV was not successful (Okayama and Berg, II, supra). The HPRT sequence is present in the library used in that study at a frequency of approximately -5 S2 X 10 and, when isolated by colony hybridization techniques and transfected into HPRT deficient cells as a purified plasmid, conferred resistance to HAT media.
However, mixing experiments demonstrated that HPRT cells are obtained only if the HPRT containing cDNA is present at 15 -3 -4 a frequency of greater than 1 X 10 3 to 1 X 10 To i obtain this frequency, in the case of the HPRT gene, it is ii* necessary to enrich for this sequence by a factor of i approximately 100 over the concentration in the original i cDNA library. By construction of cDNA libraries in one of s 20 the pcDpoly B vectors from cells which express a cDNA such as HPRT, for which a function can be assayed and enrichment of this library by subtractive hybridization/selection H using a second library constructed in one of the BSB vectors from cells which do not express the function (in 25 this case an HPRT- deletion mutant), it is possible to Sobtain sublibraries which are sufficiently enriched to i* isolate even relatively rare sequences on the basis functional assays. This approach is applicable to any situation where closely related cell types which differ in i i 30 i’ 3 their expression of a given gene product can be identified.
I e -19- A deposit of a biologically pure culture of the Sfollowing strains was made with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland on June 9, 1988 and accession numbers indicated were accorded after successful viability testing and the Srequisite fees were paid. All restrictions on the availability of said cultures to the public have been irrevocably removed and said cultures will remain permanently available for a term of at least five years after the most recent request for the furnishing of a sample and in any case 30 years after the date of deposit.
Should the culture become nonviable or be inadvertently i destroyed, it will be replaced with a viable culture(s) of i the same taxonomic description.
«.15 Strain ATCC No.
S. Plasmid in Escherichia coli strain HB101, BSB+ 67724 BSB- 67725 S,pcDpolyB+ 67726 20 S,pcDpolyB- 67727 i The following examples further illustrate the *j present invention.
I -7 EXAMPLE 1 1 i Recombinant DNA Procedures Unless otherwise specified herein, manipulation of recombinant molecules and the preparation of solutions Sare by standard, known techniques. Such techniques are described in Maniatis, et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, 1982, ppl- 5 0 0 SCell Cultures and Preparation of Polyadenylated RNA i Both F9 (Bernstine, et al., P.N.A.S.
70:3899-3903, 1973) and P19S1801A1 (McBurney, et al., Nature 299: 65-167, 1982) cells are cultured in DME supplemented with 10% fetal calf serum. To induce 15 differentiation of F9 cells, approximately 10 cells/ml are i cultured in bacterial grade petri dishes in the presence of -7 10 M retinoic acid for 5 days (Hogan, et al., Nature 291: I* ‘235-237, 1981). Aggregates are collected by centrifugation i. *2 at 500 X g for 5 minutes and cells are lysed by addition of SI’.2 100 volumes of a solution containing 4 M guanidine V isothiocyanate, 5 mM Na- citrate (pH 1 mM Vi beta-mercaptoethanol and 0.5 sarkosyl (GITC solution). Three different protocols are used to induce i differentiation of 01A1 cells as described by McBurney, et al., supra. For induction of aggregates with either retinoic acid or DMSO, a suspension of approximately 10 i cells/ml is grown in bacterial grade petri dishes in the -7 presence of either 10 M retinoic acid or 0.4% DMSO for 3 days. Cells are then transferred to tissue culture .30 dishes and cultured in the absence of inducer for various times. For induction of monolayers i 1
I
I
Li -21- *6 CS
C
*r C *0 C
S
C
with retinoic acid, cells are plated directly onto tissue culture dishes and cultured in the presence of inducer for 3 days followed by culture in the absence of inducer for various times. To harvest the induced cultures, culture media is removed and 5 ml of GITC solution is added to each dish of cells. RNA is isolated from the homogenates by addition of 1.5 g CsCl/2.5 ml of homogenate and the homogenate is layered over a 1.5 ml cushion of 5.7 M CsC1, mM Tris-HC1 (pH 1 mMv EDTA and centrifuged for 24 hours, at 25,000 rpm in an SW rotor (Maniatis, et al., supra). The RNA pellet is resuspended in 300 ul of 10 mM Tris-HCl (pH 1 mM EDTA, 1% SDS, and 1 mg/ml protease K, extracted once with phenol and once with 25:1 chloroform:isoamyl alcohol and precipitated by .(.dition of Na-acetate (pH 5.5) to 0.3 M and 2 volumes of ethanol. RNA 15 is resuspended in 100 ul of dH2 0 containing 1 mM dithiothreitol and 100 units of RNasin (Promega).
Polyadenylated RNA is isolated using oligo dT cellulose paper (Amersham) as described by the manufacturer.
20 Oligo dT Tailing of Vector DNA Vector DNA are prepared for use by digesting 200 ug with 400 units of Kpn 1 (BRL or NEB) in 400 ul of digestion buffer for 3 hours. DNA is CHC1 3 OH extracted, ethanol precipitated and resuspended in 200 ul of 10 mM TRis-HC1, 1 mM EDTA Approximately 50 ul of terminal deoxynucleotidyl transferase (TdT) reaction buffer (100 mM potassium cacodylate, pH 7.2, 2 mM CoC12 and 0.2 mM diothiothreitol), TTP to a final concentration of 240 mM and 100 units of TdT (BRL) are added and the reaction incubated at 37 0 C. for 30 minutes. The reaction is stopped
TT
0.
ij’ -22by addition of 10 ul of 0.5 EDTA, extracted twice with CHC1 -OH and DNA precipitated by addition of Na-acetate to 0.3 M and 2 volumes of ethanol. Following resuspension in 200 ul TE and reprecipitation, the DNA is resuspended in 360 ul TE and either 40 ul of 10 X Xba 1 digestion buffer and 400 units of Xba 1 (BRL) in the case of pcDpolyB+ or B- (See Example 2) or 40 ul of 10 X Bam H1 digestion buffer and 400 units of Bam Hl (BRL) in the case of BSB+ or BSB- (See Example 2) are added, the reaction is incubated at 37 0 C. for 3 hours and DNA electrophoresed on 1% (w/v) agarose gels. The vector fragment is isolated on DE B1 paper, recovered by elution with 1.0 M NaCI, 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA and precipitated by addition of 2 volumes of ethanol. The pellet is resuspended in 300 ul TE and NaC1 is added to a final concentration of 1 M. Oligo dT tailed vector DNA are then purified by binding and elution from an oligo (dA)-cellulose column as described by Okayama and Berg I, supra. The DNA elute from the column is extracted 1 X with CHC1 3 -OH, ethanol precipitated and resuspended in 50 ul of TE.
ji
D
r 4 4
S**
Construction of cDNA Libraries The construction of a cDNA clone is summarized in Fig. 2, exemplified using pcDpolyB-.
Step 1. First Strand cDNA Synthesis First strand cDNA synthesis was performed essentially as described by Okayama and Berg I, supra, except that the reaction also contained 40 units of RNasin and is performed in a final volume of 20 ul/ug of vector DNA at 42 0 C. for 60 minutes. The reaction is stopped by addition of 170 ul TE, 5 ul 0.5 M EDTA and 5 ul 10% (w/v) SDS. The solution is extracted once X.ith phenol, once with CHC13-OH and precipitated by addition of 200 ul NH4Ac and 4 -23- 800 ul of ethanol, incubation at room temperature for 1minutes and centrifugation. The pellet is washed with ethanol, resuspended in 200 ul TE and reprecipitated as before.
Step 2. Oligo (dC) Addition The pellet containing the vector-cDNA-RNA hybrid is resuspended in 73 ul of TE, 20 ul of 5 X TdT buffer, dCTP to a final concentration of 25 uM and 1.5 units of TdT are added and the reaction is incubated at 37 0 C. for 30 minutes resulting in the addition of approximately 5 to 10 dC residues per end. The reaction is stopped by addition of ul of 0.5 M EDTA and 5 ul of 10% SDS, extracted once with CHC1 OH and precipitated by addition of 110 ul 3
SNII
4 -acetate and 440 ul of ethanol.
Step 3. Bst X1 Digestion SThe pellet from the oligo dC tailing step is resuspended in 45 ul of TE, 5 ul of 10 X BstXI digestion buffer, and 10 units of BstXI (NEB) are added. The 20 reaction is incubated at 55 0 C. for 60 minutes and stopped by extraction with phenol 1 X, CHC1 -OH 1 X and precipitation with 5 ul of Na-acetate and 120 ul of ethanol.
Step 4. Ligation and 25 Second Strand cDNA Synthesis The pellet from the BstXI digestion step is resuspended in 900 ul of TE and 100 ul of 10 X ligation buffer (660 mM Tris-HCl pH 7.6, 66 mM, MgCl 2 100 mM DTT, 1 mM ATP) and 10 units of T4 DNA ligase (BRL) are added.
30 The reaction is incubated overnight at 15 0 transferred -24to 4 0 C. and supplemented with 1 ul 10 mM ATP, 1 unit T4 DNA ligase, each of dATP/dCTP/dGTP/TTP to a final concentration of 5 uM, 0.8 units of RNase H (Amersham) and 25 units of DNA polymerase 1 (Amersham). The reaction is then incubated at 12 0 C. for 60 minutes, 22 0 C. for 60 minutes and 12 0 C. for 60 minutes.
Step 5. Transformation and Amplification of cDNA Libraries The second strand synthesis reaction is divided into 100 ul aliquots and each aliquot is used to transform 400 ul of competent E. coli strain MC 1061 cells.
Competent cells are prepared by pelleting a culture of MC 1061 cells grown in L-broth to an O.D. 650 nM of 0.6, resuspending the cells in 1/2 volume of 50 mM CaC1, repelleting, resuspension in 1/25 volume of 50 mM CaCl and Sincubating at 4 0 C. for between 2 and 5 hours. Cells S* prepared in this way routinely gave a transformation efficiency of approximately 8.0 X 10 transformants/ug of 1 pBR322 DNA. Transformation is performed at 4 0 C. for 9 20 S. 0. minutes followed by 2 minutes at 45 0 C. and cells are pooled i and incubated in 500 ml of Brain Heart Infusion (GIBCO) for minutes at 37 0 C. Following incubation, aliquots are taken for titering and plated on 1.5% agar containing 100 ug/ml ampicillin. Ampicillin is also added to the 500 25 ml culture to a final concentration of 100 ug/ml.
i Following incubation at 37 0 C. for 12 hours, DMSO is added to 10 ml aliquots of the cDNA libraries to a final jI concentration of 7% the aliquots frozen in liquid N 2 and stored at -70 0
C.
_I __r ~i
I
i
I
I
I t !3 i 1 .:r
Q
i:i !;i is t::i i:» i:f i pi:8 i i ii )1 ;i 6 @9 9 9*9* 6* 6
C
6 **9 999 To prepare large quantities of double stranded cDNA, a 10 ml aliquot of the frozen library is thawed at 37 0 the cells pelleted by centrifugation at 4,000 X g for 5 minutes, resuspended in 5 ml of L-broth, inoculated to 500 ml of Brain Heart Infusion and plasmid preparations performed as described in Maniatis, et al., supra.
The synthesis of a cDNA library is summarized in Fig. 3, exemplified using pcDpolyB-. To construct a cDNA library using the vectors pcDpolyB+, pcDpolyB-, BSB+, or BSB-, the vector DNA is first prepared by digestion with Kpn 1 and an oligo (dT) tail of approximately 60-80 nucleotides is added using terminal deoxynucleotidyl transferase. The unwanted oligo (dT) tail on one end of the vector is removed by digestion with Xba 1 and the tailed vector DNA is purified as described above.
15 Polyadenylated RNA is then hybridized to the remaining oligo (dT) tail and the first strand of the cDNA insert is synthesized using reverse transcriptase. The cDNA is then oligo (dC) tailed using terminal deoxynucleotidyl transferase. To provide an oligo (dG) tail complementary 20 to the oligo (dC) tail present on the cDNA the vector-RNA-cDNA hybrid is digested with BstXI. The oligo (dC) and oligo (dG) tails are then annealed and the recircularizated vector is ligated. The RNA strand is removed using RNase H and the plasmid is repaired with DNA 25 polymerase 1.
Transfer of Libraries to Escherichia coli Strain 71-18 and Isolation of Single Stranded DNA Escherichia coli 71-18 cells are made competent for transformation using the protocol described above for MC 1061 cells. Approximately 10 times the number of 71-18 transformants as are present in the original MC 1061 i library are generated and 10 ml aliquots of the library are Sfrozen as described above. To prepare single stranded copies of the cDNA present in the library, a 10 ml aliquot of 71-18 cells containing the library is inoculated into 500 ml of brain heart infusion containing 100 ug/ml ampicillin and the culture grown to an O.D. 650 nM of 0.3.
The culture is then inoculated with a 5 ml of a saturated culture of bacteriophage VCS257-M13 (Vector Cloning System) in bacterial strain 71-18 and incubated at 37 0 C. for an additional 12 hours. Cells are removed by centrifuging the 0 culture 2 X for 5 minutes each a 5000 X g. The supernatant is brought to a final concentration of 0.3 M NaC1 and polyethylene glycol 8000, incubated at 4 0 C. for 4-8 hours and centrifuged for 10 minutes at 10,000 X g. The pellet is washed with 95% ethanol, gently resuspended 15 in 5 ml of TE, extracted once with phenol, once with CHC-OH, and the DNA precipitated by addition of S’ Na-acetate to 0.3 M and 2 volumes of ethanol and stored in 6e
TE.
20 Hybridization/Selection Specific sequences are selected from total single stranded cDNA libraries by hybridization to matrix bound probe sequences. DNA is bound to a cyanogen bromide activated sepharose matrix by procedures described in Arndt-Jovin, 25 et al., Eur, J. Biochem. 54: 411-418, 1975. In cases where a specific sequence from a purified plasmid is used as a probe, DNA fragments resulting from restriction endonuclease digestion of CsCl purified plasmids are isolated sequentially from 2-1% agarose gels by 30. collection on DE 81 paper and elution in 1 M NaCl, 10 mM i i *I -27- Tris-HCl (pH 1 mM EDTA. The DNA pellet is washed Stwice with 70% ethanol and resuspended in dH 2 0 at a concentration of approximately 1 ug/ul. To bind DNA from a cDNA library to sepharose 4B, single stranded DNA is prepared, precipitated, washed and resuspended in dH 2 0 as aforementioned described. Cyanogen bromide activated sepharose 4B (Pharmacia) is prepared for binding by washing with an approximately 100 X excess each of 1 mM HC1, dH 2 0, and 10 mM K-phosphate (pH The DNA is heated in a boiling water bath for 10 minutes and chilled on ice immediately prior to addition to the matrix. The DNA-matrix mixture is incubated at room temperature for 2-18 hours and the matrix washed sequentially with excess dH 2 0, 0.1 mM Tris-HCl (pH 8.0) 1.0 mM EDTA and incubated for 4 hours at room temperature. Following incubation the matrix is 15 washed sequentially with 10 mM K-phosphate (pH 1.0 M S K-phosphate (pH dHO and 10 mM Tris-HC1 (pH 7.5) 32 S’ 1 irM EDTA. Use of p labeled DNA demonstrates that greater than 90% of the DNA is bound under these conditions.
20 For hybridization of single stranded library DNA to matrix bound DNA, the DNA matrix (25-50 ul for specific probes and 200-500 ul for matrix bound cDNA library probes) is washed 4 .times with a 20-50 fold excess of hybridization buffer (250 mM KC1, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA).
25 Between 10 and 100 ug of single stranded cDNA library DNA in 1 X hybridization buffer is added to the matrix, the mixture is overlayed with paraffin .oil and incubated at temperatures varying between 50 0 C. and 58 0 C. for times ranging between 12 and 48 hours in different experiments.
S -28- To recover cDNA hybridizing to the matrix, the Smatrix is transferred to a 15 ml disposable column and washed with 250-500 ml of 1 X hybridization buffer, at the hybridization temperature, followed by 250-500 ml of 1/2 X hybridization buffer at 22 0 C. The matrix is recovered and 100 ul of TL added. Immediately prior to transformation, the matrix in TE is heated to 80 0 C. for 10 minutes and chilled on ice. Approximately 500 ul of competent MC 1061 cells are added and the transformation performed as absence of ampicillin is continued for 2.5 hours and the cells then pelleted and plated on agar containing 100 ug/ml ampicillin. Colonies are collected from the plates by addition of 8-10 ml of L-broth to create enriched sublibraries.
15 1 Specific cDNA Libraries i As used in the specification herein, Library 8 S refers to a cDNA library constructed using the BSB+ vector.
S* Library 9 refers to a library constructed using pcDpolyB-.
0 :i O ‘M m
I
T- -U -29- EXAMPLE 2 Ii Construction of Vectors The construction of vectors pcDpolB+ and pcDpolyB- is shown in Fig. 1. Plasmid pcDpoly is constructed by a three-way ligation between the Kpn 1 to Hind III fragment of pcDVll (containing the polyadenylation site and pBR322 sequences; Okayama and Berg supra), the Hind III to Pst 1 fragment of pLl (containing the SV40 early promoter and splice sites; Okayama and Berg supra) and the Pst 1 to Kpn 1 polylinker fragment from the vector Bluescribe M13+ (Vector Cloning Systems). Plasmid pcDpoly is converted to pcDpoly B by use of a synthetic oligonucleotide with the sequence: a0 a* 00 0 0* 0 a
*S
0o .oo oo ol lI 5′ CTAGAGCCACCCCCCTGGTGCA 3′ to insert a BstXI site 5′ CCAGGGGGGTGG between the Pst 1 and Xba 1 site of the polylinker region of 20 pcDpoly by cleaving the plasmid with Pst 1 and Xba 1, ligating to the oligonucleotide and filling in the resulting gap with the large fragment of DNA polymerase I.
Sequence analysis demonstrates that the Xba 1 site is lost at this step due to filling in and blunt end ligation 25 between the 5′ protruding end created by Xba 1 digestion of the plasmid and hybridization of the oligonucleotide to the 3′ protruding end created by Pst 1 digestion. Since a unique restriction endonuclease site located between the Bsy Xl and Kpn 1 sites is required, an Xba 1 linker is 30 inserted at the Sma 1 site located between the BstXI and Kpn 1 sites. The resulting plasmid is called pcDpoly B and has the structure shown in Fig. 1. The final step in the construction of pcDpolyB+ and pcDpolyB- is the insertion of Nde 1 to Pvu II fragment from Bluescribe M13+ (containing the bacteriophage F1 intergenic region) between the Sal 1 and Cla 1 sites of pcDpoly B using Sal 1 and Cla 1 linkers. These vectors are capable of expressing cDNA contained therein in eukaryotic cells due to the SV40 early promoter.
Vectors BSB+ and BSB- are constructed from Bluescribe M13+ or Bluescribe M13- by insertion of the aforementioned synthetic oligonucleotide between Pst 1 and Xba 1 sites of the polylinker region as described for the construction of pcDpolyB+ and pcDpolyB-.
t* 0 0 *I 0 i e *I o It, -31- EXAMPLE 3 1 Efficiency of cDNA Library Construction The vectors described in Example 2 are used to determine the efficiency of cDNA library construction using the methods of Example 1.
Specifically, libraries are constructed using the pcDpolyB- and BSB+ vectors and the efficiency with which independent transformants are obtained is determined.
The number of independent transformants obtained per ug of starting vector DNA ranged from about 2.0 to about 8.1 X and averaged about 3.0 X 106 To assay the efficiency with which near full length cDNA are incorporated into libraries produced using the BstXI cloning procedure (Example DNA from library 15 B is probed for the presence of cDNA containing sequences homologous to the hypoxanthine guanine phosphoribosyl transferase (HPPT) gene. DNA from this library is digested with Eco Rl, electrophoresed on a 1% agarose gel, «0 32 transferred to nitrocellulose and probed with a P labeled 20 250 bp HPRT containing DNA fragment (produced by digestion of the plasmid pMEV with Hind III and nick translation).
Fig. 3 (panel A, lane 3) demonstrates that the HPRT probe detects two.major bands with lengths of approximately 4.7 and 4.4 kpb. The vector BSB+ is 3.214 kbp in length, thus the HPRT containing inserts are approximately 1.5 and 1.2 kbp in length. To obtain a more accurate estimate of the 00o lengths of the inserts, library 8 (constructed using BSB+) DNA is also digested with Pvu II and probed for HPRT sequences. Pvu II cleavage sites are located at positions 30 136 bp 5′ and 362 bp 3′ to the cDNA insertion site in the S* vector. Fig. 3 (panel A, lane 4) demonstrates that the i
U
ii 0
*F
V S 1, IF S LI -32sequences detected in library B following digestion with 1 Pvu II, by the HPRT probe are 1.75 kpb and 1.55 kbp in length. Thus the lengths of the HPRT containing lengths are more accurately estimated to be 1.35 and 1.15 kbp.
Previous studies have demonstrated that the HPRT message 5 from human cells, including the 3′ polyadenylation, is approximately 1.55 kb in length (Jolley, et al. P.N.A.S. 477-481, 1983). Additionally, previous isolation of a full length cDNA using the Okayama and Berg I, supra, method yielded an approximately 1350 bp cDNA, in reasonable agreement with the predicated message size (Jolley, et al., supra). This cDNA contained an 85 bp 5′ non-translated leader region, a 654 bp coding sequence and a 3′ non-coding tail of approximately 600 bp. A 1292 bp mouse cDNA sequence has also been isolated from a library constructed 1 using an S1 nuclease step to blunt end the double stranded cDNA. The coding region in this sequence was 657 bp and is flanked by an 87 bp long 5′ leader and a 548 bp long 3′ tail. On the basis of these studies it is likely that the larger of the two classes of HPRT containing inserts 20 2 (approximately 60% present in library B, constructed using the BstXI method, contain the full coding sequence and are close to full length copies of the message.
To confirm that efficient incorporation of near to full length cDNA is also obtained using the pcDpolyBvector, library 9 (constructed using pcDpolyB-) is screened for the presence of cDNA homologous to the message encoding alpha-fetoprotein. The alpha-fetaprotein message is approximately 2.2 kbp in length (Scott, et al., Nature 310: 562-567, 1984) and the vector pcDpolyB- is 3.7 kbp in length, thus a plasmid containing the full length cDNA should be approximately 5.9 kbp. Library 9 DNA is digested 5555 S. S 0 S *S 55 S S
,D»
-33with Sal 1 for which there is a single recognition sequence Spresent in the vector and no recognition sequence in the cDNA, electrophoresed on a 1% w/v) agarose gel, transferred to nitrocellulose and probed for alpha-fetoprotein sequences using a 1.1 kbp probe (produced by Eco R1 digestion of the plasmid pAFP2E homologous to the 3′ end of the message. Fig. 3 (panel B, lane 2) demonstrates that approximately 60% of the plasmids present in library 9 which contain sequences homologous to this probe are approximately 5.8 kbp in length and are near to full length Scopies of the alpha-fetoprotein message. A high proportion of near-full length HPRT containing cDNA (25-30%) have also been detected in library 9 (discussed below).
see*:* *0 e Va
*I
3 0 3 9 9 9 99 999.
9. 9.
9 z. I 9 99 *9 *99999 -34- EXAMPLE 4 1 Enrichment of HPRT Containing cDNA by Hybridization/Selection To test the efficiency with which a specific cDNA is recovered as a single stranded DNA, library 8 is transferred to E. coli strain 71-18 which exhibits the F phenotype. The library in strain 71-18 is grown to an O.D.
650 mM of 0.3 and superinfected with an approxi- mately 20:1 ratio of the bacteriophage VCSM13 (a derivative of Fl, Vector Cloning Systems), the culture is incubated for an additional 8-12 hours and single stranded DNA was isolated, electrophoresed on a 1% agarose gel and probed for HPRT sequences using the 250 bp Hind III probe fragment from pMEV described above. Fig. 4, lane 1, shows the single stranded DNA following staining with ethidium bromide and demonstrates that the cDNA containing plasmids are recovered in approximately a 1:1 ratio relative to the helper virus DNA (marked with an asterisk). Fig. 4, lane 2, shows the same DNA following transfer to a nitro- 20 cellulose filter hybridization to the HPRT probe and autoradiography. A band migrating slightly larger than the bulk of the cDNA and BSB+ vectors is detected demonstrating the plasmids containing the HPRT sequence are present.
Similar results have been obtained for both the HPRT and AFP cDNA present in Library 9.
To determine if a specific cDNA sequence is recovered efficiently from a single stranded cDNA library, the 250 bp Hind III fragment from the plasmid pMEV is used as a probe to attempt to recover HPRT containing cDNA from 30 Library 9. The probe fragment is denatured and bound to a cyanogen bromide activated sepharose 4B matrix using 1 approximately 10 ug of DNA/50 mg of matrix. The probematrix is then washed repeatedly as described in Example 1 and resuspended in hybridization buffer (250 mM KC1, 10 mM TRis-HCl pH 7.5, 1 mM EDTA). Single stranded Library 9 DNA (50 ug) is then added in hybridization buffer to approximately 25 ul of the probe-matrix such that the final Library 9 DNA concentration is 1 mg/ml in a total volume of ul. The reaction is overlayered with paraffin oil, heated to 80 0 C. for 5 minutes, and transferred to 55 0 C. for S18 hours. Following hybridization, the matrix is transferred to a 15 ml disposable column and washed with a total volume of 500 ml 1 X hybridization buffer at 550C.
i followed by 250 ml 1/2 X hybridization buffer at room temperature. The matrix is recovered and resuspended in I 15 100 ul of TE buffer, heated to 80 0 C. for 10 minutes, S* transferred to ice and used to transform competent MC 1061 cells. Transformants were grown in the absence of selection for 2.5 hours and plated to agar containing 100 ug/ml ampicillin. Approximately 5,000 clonies are obtained. To determine whether HPRT containing cDNA are present in the transformants, the transformants are pooled by addition of L-broth to the plates and the resulting bacterial suspension is cultured for approximately 12 hours at 37 0 C. A portion of each culture is then utilized to 25 establish a frozen stock and the remainder used to prepare DNA using standard and known miniprep procedures. The isolated DNA is digested with the restriction enzyme Sal 1, which cleaves once in the vector but not in the HPRT sequence and the digested DNA electrophoresed on a 1% (w/v) .1 0 agarose gel in parallel with 5 ug of the unfractioned Sal 1 -36digested Library 9 DNA. The results of this assay are shown in Fig. 5, where panel B, lane 1, shows the unselected library DNA and lane 2 shows the HPRT selected DNA after staining the ethidium bromide. To determine if the selected sublibrary contained HPRT cDNA, the DNA is transferred to nitrocellulose and probed with the 250 bp pMEV probe fragment described above. Comparison of panel A, lane 1 (unfractioned Library 9) with panel B, lane 3 (pMEV selected Library 9) of Fig. 5, demonstrates that HPRT containing cDNA are present in the selected sublibrary.
The degree of enrichment as determined by densitometry is at least 500 fold.
i i 35
*A
L -37- EXAMPLE 1 Bst X1 Recognition of cDNA:RNA Hybrids A potential problem with the use of BstXI to generate the oligo (dG) cohesive end is the possibility this enzyme will recognize and cleave B t X1 sites present in the cDNA:RNA hybrids. To test this possibility, a single stranded probe containing a BstXI recognition site is made by 5′ 32P labeling the Hind III site present in the polylinker region of the plasmid BSB+, digesting the plasmid with Pvu II and isolating the single stranded 172 bp DNA fragment from a strand separation gel. This probe is then hybridized to a transcript, from the same plasmid, generated using T7 RNA polymerase and the DNA:RNA hybrid 1 digested with BstXI. To insure that digestion of only the S* 15 DNA:RNA hybrids, and not unhybridized single stranded probe S* is assayed, the hybrids are then digested with S1 nuclease.
A protected fragment of 72 bp is expected to follow S1 nuclease digestion if BstXI did not cleave the DNA:RNA hybrid. The results of this experiment are shown in Fig.
20 6A, where lane 1 shows the 72 bp protected fragment resulting S1 nuclease digestion alone and lane 2 shows the protected fragment following digestion with BstXI and S1 nuclease. Comparison of these bands demonstrates -hat little or no digestion of the RNA:DNA duplexes occurred. To 25 assay for BstXI digestion of double stranded DNA, unlabeled BSB+ DNA is included in the same reactions and eel the extent of digestion of this template is assayed by electrophoresis on 1% agarose gels and staining with ethidium bromide as shown in Fig. 6B. Comparison of lane 1 L 30 (no BstXI) with lane 2 (plus BstXI) demonstrates that, in Ii -38contrast to the fNA:DNA hybrid, greater than 95% of the BstXI sites present in double stranded DNA are cleaved under these conditions. These results suggest that digestion of the vector:cDNA:RNA hybrid with BstKT does not result in cleavage within the cDNA sequences.
S
S.
5 3555 S. *5 5 5
I’
S S *S S S
S
S.
S S 55555*

Claims (14)

1. A recombinant DNA molecule comprising: a prokaryotic origin of replication; a selectable marker; a deoxyribonucleic acid sequence permitting synthesis of said recombinant DNA molecule in a single-stranded form; and a unique restriction endonuclease site permitting i) a re-circularization of the linear form of said recombinant DNA molecule containing cDNA by intramolecular ligation; and, ii) priming of second strand cDNA synthesis.

2. The recombinant DNA molecule according to Claim 1 wherein the prokaryotic origin of replication is S 15 15 derived from pBR322.

3. The recombinant DNA molecule according to Claim 1 or 2 wherein the selectable marker is an antibiotic resistance gene. Ca 4. The recombinant DNA molecule according to t 0 Claim 3 wherein the antibiotic resistance gene encodes resistance to ampicillin. The recombinant DNA molecule according to any of Claims 1 to 4 wherein the deoxyribonucleic acid sequence permitting synthesis of said recombinant DNA *25 molecule in single- stranded form is the intergenic region from bacteriophage Fl.

6. The recombinant DNA molecule according to any of Claims 1 to 5 wherein said unique restriction i endonuclease site is BstXI. I 30

7. The recombinant DNA molecule according to claim 6 wherein said molecule is BSB+ as hereinbefore defined, contained in Escherichia coli deposited under the ATCC accession number 67724 or is BSB-, as hereinbefore defined, contained in Escherichia coli deposited under ATTC accession number 67725.

8. The recombinant DNA molecule according to any of claims 1 to 6 which further comprises a eukaryotic origin or replication and a eukaryotic promoter.

9. The recombinant DNA molecule according to claim 8 wherein said eukaryotic origin of replication is derived from Simian Virus 40 and the eukaryotic promoter is the Simian Virus 40 early promoter. The recombinant DNA molecule according to claim 9 wherein said molecule is pcDpolyB+, as hereinbefore described, contained in Escherichia coli deposited under ATCC accession number 67726 or is pcDpolyB-, as hereinbefore defined, contained in Escherichia coli deposited under ATCC accession number 67727.

11. A host cell transformed with the recombinant DNA molecule according to claim 6 or 7 or 9 or

12. The host cell according to claim 11 wherein i said host is Escherichia coli.

13. A process for preparing a circular recombinant DNA molecule containing a first cDNA strand said process comprising: annealing poly (A) RNA to an oligo (dT) primer, said primer linked to a linear form of said recombinant DNA molecule; S910802,ejhspe.054,36313.spe,40 -41 permitting synthesis of said cDNA strand; terminating said strand with oligo and re-circularising the resulting molecule by an intramolecular ligation-between the oligo (dG) terminated cDNA strand and an oligo (dC) terminus, said oligo (dC) terminus generated following the digestion of said complex with a unique restriction cndonuclease.

14. The process according to claim 13 wherein the unique restriction endonuclease is Bst XI. Recombinant DNA molecules according to claim 7 or 10 and which individually further comprise a first cDNA strand and optionally a second cDNA strand.

16. A process for enriching a cDNA library in a first recombinant DNA molecule for specific nucleic acid sequences comprising annealing single stranded forms of cDNA containing said first recombinant DNA molecules to :single-stranded forms of a second recombinant molecule containing the nucleic acid sequence to be enriched, wherein the first and second recombinant DNA molecules are according to any one of claims 1 to 10 with the proviso that the first and second recombinant DNA molecules have the intergenic region from bacteriophage Fl in opposite orientations relative to each other.

17. The process according to claim 16 wherein the first and second recomlinant DNA molecules are respectively selected from the pairs consisting of pcDpolyB- and BSB+, pcDpolyB+ and BSB-, BSB- and pcDpolyB+, BSB+ and pcDpolyB-, each as hereinbefore defined. 910802,ejhspe.054,36313.spe,41 1 -42-

18. A recombinant DNA molecule according to claim 1, substantially as hereinbefore described with reference to the Examples. DATED this 7th day of August, 1991 HEALTH RESEARCH INC. By its Patent Attorneys DAVIES COLLISON i 4LIAjN i. ko 910807,ejhspe.054,36313.spe,42

AU36313/89A
1988-06-14
1989-06-14
Novel cdna cloning vectors

Ceased

AU619303B2
(en)

Applications Claiming Priority (2)

Application Number
Priority Date
Filing Date
Title

US20642688A

1988-06-14
1988-06-14

US206426

1988-06-14

Publications (2)

Publication Number
Publication Date

AU3631389A

AU3631389A
(en)

1990-02-01

AU619303B2
true

AU619303B2
(en)

1992-01-23

Family
ID=22766324
Family Applications (1)

Application Number
Title
Priority Date
Filing Date

AU36313/89A
Ceased

AU619303B2
(en)

1988-06-14
1989-06-14
Novel cdna cloning vectors

Country Status (4)

Country
Link

EP
(1)

EP0346877A1
(en)

JP
(1)

JPH02186991A
(en)

AU
(1)

AU619303B2
(en)

CA
(1)

CA1335428C
(en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party

Publication number
Priority date
Publication date
Assignee
Title

AU652566B2
(en)

1990-06-18
1994-09-01
United States of America, as represented by the Secretary, U.S. Department of Commerce, The
Eukaryotic expression vector system

US5962271A
(en)

1996-01-03
1999-10-05
Cloutech Laboratories, Inc.
Methods and compositions for generating full-length cDNA having arbitrary nucleotide sequence at the 3′-end

Citations (3)

* Cited by examiner, † Cited by third party

Publication number
Priority date
Publication date
Assignee
Title

EP0092388A2
(en)

1982-04-16
1983-10-26

Eli Lilly And Company

Cloning vectors

EP0153154A1
(en)

1984-02-14
1985-08-28

Lubrizol Genetics Inc.

Transfer vector

EP0218468A2
(en)

1985-10-01
1987-04-15

Banyu Seiyaku Kabushiki Kaisha

Safe, versatile cloning vector

1989

1989-06-12
CA
CA000602526A
patent/CA1335428C/en
not_active
Expired – Fee Related

1989-06-14
AU
AU36313/89A
patent/AU619303B2/en
not_active
Ceased

1989-06-14
EP
EP89110816A
patent/EP0346877A1/en
not_active
Ceased

1989-06-14
JP
JP15353489A
patent/JPH02186991A/en
active
Pending

Patent Citations (3)

* Cited by examiner, † Cited by third party

Publication number
Priority date
Publication date
Assignee
Title

EP0092388A2
(en)

1982-04-16
1983-10-26
Eli Lilly And Company
Cloning vectors

EP0153154A1
(en)

1984-02-14
1985-08-28
Lubrizol Genetics Inc.
Transfer vector

EP0218468A2
(en)

1985-10-01
1987-04-15
Banyu Seiyaku Kabushiki Kaisha
Safe, versatile cloning vector

Also Published As

Publication number
Publication date

AU3631389A
(en)

1990-02-01

EP0346877A1
(en)

1989-12-20

CA1335428C
(en)

1995-05-02

JPH02186991A
(en)

1990-07-23

Información de contacto