AU5448990A

AU5448990A – Processes and compositions for the isolation of human relaxin
– Google Patents

AU5448990A – Processes and compositions for the isolation of human relaxin
– Google Patents
Processes and compositions for the isolation of human relaxin

Info

Publication number
AU5448990A

AU5448990A
AU54489/90A
AU5448990A
AU5448990A
AU 5448990 A
AU5448990 A
AU 5448990A
AU 54489/90 A
AU54489/90 A
AU 54489/90A
AU 5448990 A
AU5448990 A
AU 5448990A
AU 5448990 A
AU5448990 A
AU 5448990A
Authority
AU
Australia
Prior art keywords
polypeptide
asp
ala
chain
ser
Prior art date
1989-05-04
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)

Granted

Application number
AU54489/90A
Other versions

AU623518B2
(en

Inventor
Dennis J. Henner
Richard I. Vandlen
James A. Wikins
Daniel G. Yansura
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)

Genentech Inc

Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
1989-05-04
Filing date
1990-04-16
Publication date
1990-11-29

1990-04-16
Application filed by Genentech Inc
filed
Critical
Genentech Inc

1990-11-29
Publication of AU5448990A
publication
Critical
patent/AU5448990A/en

1992-05-14
Application granted
granted
Critical

1992-05-14
Publication of AU623518B2
publication
Critical
patent/AU623518B2/en

2010-04-16
Anticipated expiration
legal-status
Critical

Status
Ceased
legal-status
Critical
Current

Links

Espacenet

Global Dossier

Discuss

Classifications

C—CHEMISTRY; METALLURGY

C07—ORGANIC CHEMISTRY

C07K—PEPTIDES

C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans

C07K14/575—Hormones

C07K14/64—Relaxins

A—HUMAN NECESSITIES

A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE

A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS

A61P13/00—Drugs for disorders of the urinary system

A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers

A—HUMAN NECESSITIES

A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE

A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS

A61P15/00—Drugs for genital or sexual disorders; Contraceptives

Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS

Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC

Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS

Y10S435/00—Chemistry: molecular biology and microbiology

Y10S435/8215—Microorganisms

Y10S435/822—Microorganisms using bacteria or actinomycetales

Y10S435/848—Escherichia

Y10S435/849—Escherichia coli

Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS

Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC

Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS

Y10S930/00—Peptide or protein sequence

Y10S930/01—Peptide or protein sequence

Y10S930/31—Linker sequence

Description

PROCESSES AND COMPOSITIONS FOR THE ISOLATION OF HUMAN RELAXIN
The present invention is directed to improved processes and compositions for the isolation of proteins, and to novel genetic constructions allowing the ready isolation of desired proteins or peptides, particularly multi-chain proteins such as human relaxin that are essentially devoid of aspartic acid (“Asp”) residues.
The production and isolation of desired proteins by recombinant techniques, for example, employing genetically engineered or isolated gene sequences, has in recent years reached a moderate level of sophistication. In fact, it is now possible to produce a variety of proteins by recombinant techniques, including, for example, recombinant human interferon, human growth hormone, or human tissue plasminogen activator, to name just a few, in a variety of hosts, including both eukaryotic and prokaryotic hosts [Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor: New York, 1982)]. Moreover, techniques for moving or “engineering” DNA sequences from one context to another, for example, translocation of sequences from one recombinant vector or host to another vector or host, is currently achievable on a routine basis. Such successes have allowed the production and ready availability of a number of important pharmaceutical and biotechnical products, in a form essentially free of materials normally associated with the protein in its natural environment. Unfortunately, certain proteins are expressed by recombinant means only with some difficulty. For example, certain proteins, and in particular certain protein hormones, naturally exist in a mature form quite distinct from their cellular nascent form, requiring processing, often the action of a series of enzymes. Such proteins are said to exist in pre- , pro-, or pre/pro- forms. Processing of such proteins will also often result in the generation of two or more individual peptide chains, one or both of which may have biological activity, or which may themselves form bonds or crosslinks resulting in multi- chain proteins, e.g., insulin or relaxin.
The principal problem encountered in generating such proteins is the requirement that pre- and post-sequences, or internally located sequences, be somehow removed to provide the mature protein. Under certain circumstances, such a problem has been reduced or minimized through the use of eukaryotic expression systems wherein the expressed protein or peptide is adequately processed by the eukaryotic host. Unfortunately, such in vivo processing is not always entirely faithful. When this is the case, one is left with a pre- or pro-protein material, often exhibiting only slight or low intrinsic levels of biological activity. Without a convenient means of further processing these proteins, they are only of minimal or no use medically or otherwise. Moreover, in certain instances it is preferable to produce recombinant expression products in a prokaryotic host, such as a bacterium, wherein much larger quantities of expression product may at times be produced more economically. An example of a protein that ordinarily must be post-translationally modified, e.g., into separate protein chains, is human relaxin. Relaxin is a mammalian peptide hormone

that plays an important role in facilitating the birth process through its effects in dilating the pubic symphysis [see, e.g., Hisaw, Proc. Soc. Exo. Biol. Med.. 23: 661 (1926)]. Relaxin is synthesized and stored in the corpora lutea of ovaries during pregnancy and is released into the blood stream prior to parturition. Its primary physiological actions appear to be involved in preparing the female reproductive tract for parturition. These actions include dilation and softening of the cervix, inhibition of uterine contractions, and relaxation of the pubic symphysis and other pelvic joints.
The availability of ovaries from pregnant animals has enabled the isolation and amino acid sequence determination of relaxin from pig [see, e.g., Schwabe et al., Biochem. Biophvs. Res. Comm.. 75: 503-510 (1977); James et al., Nature. 267:544-546 (1977)], rat [John et a , Endocrinology. 108: 726-729 (1981)], and even shark [Schwabe et al., Rec. Proer. Horm. Res.. £4: 123-211 (1978)]. Moreover, recombinant DNA techniques have allowed the cloning and expression of various relaxins, including, in particular, porcine relaxin [see EPO Pub. No. 86,649] and human relaxin [see, e.g., EPO Pub. No. 101,309 and U.S. Pat. No. 2,758,516.
From the foregoing and other work, it is now known that the relaxin molecule, including both its initial translation transcript (prepro relaxin) and processed mature form (relaxin), bear a striking resemblance to corresponding forms of insulin. For example, relaxin is originally translated in a “prepro” form that bears a prehormone sequence (thought to play a role in extrusion and possibly folding of the peptide in the endoplasmic reticulum) and a prohormone sequence comprising three regions, the so-called B, C, and A chain- coding regions (generally arrayed in that order). Post-translational processing of preprorelaxin to form mature relaxin involves the enzymatic cleavage, in its natural cellular environment, of pre- and C-region peptides to leave the B and A chain peptides, joined by disulfide bonds through cysteine residues, as well as an intra-chain disulfide bridge within the A-chain itself.
In man, relaxin is only found in one of two potential forms, designated herein as the Aspx or H2 (human 2) and Lyst or HI (human 1) forms, corresponding to the two potential gene products in the human genome. In both forms, the A chain is devoid of Asp residues. However, in the H2 form, the relaxin B chain includes one Asp residue at position 1, whereas in the HI form, the relaxin B chain includes Asp residues at positions 4 and 5.
There has existed a need for compositions and processes particularly adapted for the isolation of recombinant proteins that must be extensively processed through the removal of terminal and/or central peptides. Fusion polypeptides have been prepared from appropriate microbial cloning systems that contain a methionyl residue at the fusion juncture for cleavage by cyanogen bromide. See, e.g., U.S. Pat. No. 4,356,270 issued Oct. 26, 1982. Moreover, linkers have been devised that code for an amino acid sequence representing a specific cleavage site of a proteolytic enzyme for cleavage of fusion proteins. See, e.g., U.S. Pat. No. 4,769,326 issued Sept. 6, 1988. Such processes provide recombinant technology with alternatives to eukaryotic cell expression.

Further, it is known that a preferential hydrolysis of the peptide bonds of aspartyl residues occurs in dilute acid, resulting in cleavage of the peptide chain [see, e.g., Light, Meth. Enz. Vol. XI, p. 417-420 (1967); Ingram, Meth. Enz.. Vol. VI, p. 831-834 (1963); Inglis et al. in Methods in Peptide and Protein Sequence Analysis. Birr, ed. (New York: Elsevier/North Holland Biomedical Press, 1980), pp. 329-343; Inglis, Meth. Enz.. £1, 324- 332 (1983); Schroeder et al., Biochemistry. 2: 992-1008 (1963) (p. 1005, left column, in particular); and Schultz, Meth. Enz.. Vol. XI, p. 255-263 (1967)], and that preferential cleavage of aspartyl- prolyl peptide bonds takes place in dilute acid [see Marcus, Int. J. Peptide Proteins Res.. 25: 542-546 (1985); Piszkiewicz et al., Biochem. Biophvs. Res. Comm.. 4Q: 1173-1178 (1970); Jauregui-Adell and Marti, Anal. Biochem.. <>9: 468-473 (1975); Landon, Meth. Enz.. 47: 145-149 (1977)]. The Jauregui-Adell article suggests cleaving the Asp-Pro bond in the presence of strong denaturing agents to obtain reasonable yields. The Landon review article discloses that the use of guanidinium chloride is necessary to increase yields for one protein but not for another. The Inglis et al. article on p. 338 suggests that variations in amino acid sequence and environment surrounding the aspartic acid residues might affect the cleavage yields. For a thorough review of all nonenzymatic methods for preferential and selective cleavage and modification of proteins, see Witkop, in Advances in Protein Chemistry. Anfinsen et al., ed., Vol. 16 (Academic Press, New York, 1961), pp. 221-321, especially pp. 229-232 on aspartic acid cleavage. UK 2,142,033 discloses cleavage of a fusion protein of IGF-I and Protein A by dilute acid treatment of a variant of the fusion protein having an Asp residue engineered at the proper fusion junction.
Despite this knowledge, there still exists a need for improved methods to produce and isolate recombinant proteins, particularly those that must be extensively processed by removal of central and terminal peptides, in high yield, and to provide for the restructuring of recombinant products into more desirable forms, for example, for the production of larger quantities of peptides having more desirable structures for expression purposes.
In recognition of these needs, it is a general object of the present invention to provide improved recombinant processes and compositions for the production of protein- or peptide-encoding DNA sequences.
It is an additional object of the present invention to provide improved processes for the production of desired proteins employing genetically engineered compositions.
It is a more particular object of the present invention to provide improved processes for providing recombinant relaxin, and in particular, human relaxin. Accordingly, the present invention is directed to a process for cleaving a polypeptide into polypeptide cleavage products comprising treating a reduced, free-cysteine form of the polypeptide with a cleaving agent under conditions for cleaving the polypeptide at a desired junction between the polypeptide cleavage products.
In a more specific aspect, the invention provides a process for cleaving a polypeptide into polypeptide cleavage products comprising:

a) culturing cells containing DNA encoding said polypeptide, wherein an Asp codon is present in said DNA at a junction between the DNA sequences encoding the respective cleavage products, said culturing resulting in expression of the DNA to produce the polypeptide in the host cell culture; and b) treating a reduced, free-cysteine form of the polypeptide with acid at a pH of about 1 to 3 under conditions for cleaving the polypeptide at the Asp junction.
Preferably, before step (a) the cells are transformed with an expression vector comprising said DNA operably linked to control sequences recognized by the cells. Additionally preferred steps include recovering the polypeptide from the host cell culture and maintaining the recovered polypeptide under a non-oxidizing atmosphere before treatment with the acid, separating and isolating at least one of the polypeptide cleavage products after the acid treatment, and combining the isolated cleavage product with another peptidyl fragment or component, e.g., a cleavage product of the polypeptide.
In a still further aspect, the invention provides a process comprising (a) providing a polypeptide under reducing conditions whereby the cysteine residues of the polypeptide are not disulfide bonded and (b) hydrolyzing a predetermined peptide bond in the polypeptide.
In another aspect, the invention provides a process for producing biologically active human relaxin comprising the steps of: a) providing an expression vector comprising DNA whose sequence encodes a polypeptide comprising a human relaxin A chain wherein an Asp codon is introduced at either one or both ends of the A chain, and wherein the DNA is operably linked to control sequences recognized by a host cell; b) transforming a suitable host cell with said vector; c) culturing the transformed cell so as to express the DNA, thereby producing a polypeptide sequence comprising the A relaxin chain; d) recovering the polypeptide from the culture; e) treating a reduced, free-cysteine form of the recovered polypeptide with acid at a pH of about 1 to 3 under conditions for cleaving the polypeptide at the Asp junction(s) to form cleavage products; f) separating the cleavage products; and g) combining the A chain with a human relaxin B chain to produce biologically active human relaxin.
In other aspects the invention supplies a process or providing nucleic acid encoding a polypeptide that is desired to be cleaved comprising introducing at a desired cleavage junction codons encoding the amino acid sequence Xn-Y-Asp, wherein X is any one of Pro, Ala, Ser, Gly, or Glu, Y is Ala, Ser, or Gly, and n is equal to or greater than 0.
In a more specific aspect, the invention furnishes a process for providing nucleic acid encoding a variant of precursor human relaxin comprising C and A chains, which process comprises introducing codons encoding, at the C-terminus of the C chain, the sequence Xn- Y-, wherein X, Y and n are defined above, preferably Ser-GIu- Ala-Ala, and inserting an
Asp codon between the C and A chains.

Additionally provided is a nucleic acid encoding a polypeptide that is desired to be cleaved, which nucleic acid encodes, at a desired cleavage junction, the amino acid sequence Xn-Y-Asp, wherein X, Y, and n are defined above.
In a more specific embodiment is provided a nucleic acid encoding a variant of precursor human relaxin comprising C and A chains, which nucleic acid comprises codons encoding, at the C-terminus of the C chain, the sequence Xn-Y, wherein X, Y and n are defined above, preferably Ser-Glu-Ala-Ala, and has an Asp codon inserted between the
C and A chains.
Also contemplated are expression vectors comprising this nucleic acid and host cells transformed with this vector.
Additionally provided is a polypeptide that is desired to be cleaved, which polypeptide comprises, at a desired cleavage junction, the amino acid sequence Xn-Y- Asp, wherein X, Y, and n are defined above.
Still a further aspect of the invention is a precursor human relaxin variant comprising C and A chains, having at the C-terminus of the C chain the sequence Xn-Y, wherein X,
Y, and n are defined above, preferably having the four C-terminal amino acids of the C chain replaced with Ser-GIu- Ala- Ala, and having an Asp residue inserted between the C and A chain.
The present invention is directed to solving the problems identified above by providing an improved means to synthesize, and process in vitro desired proteins, protein chains, or even smaller peptides. In one aspect, the invention utilizes the specific placement of Asp residue codons into protein-encoding regions of DNA molecules, which codons are expressed along with such regions into a “mutant” protein. Then, using reducing conditions and then techniques for protein cleavage that employ mild acid to cleave specifically at both the amino and carboxy moieties of Asp residues of a reduced protein, the peptidyl regions adjacent to the Asp residues are cleaved apart.
One particular use for this process is in the generation of “multi-chain” proteins such as human relaxin that exist in a native, more highly active form as A and B peptide chains, bridged together by disulfide bonds. In such embodiments, the DNA sequences encoding one peptide chain are genetically engineered to be separated from sequences that code for another chain by one or more Asp codons (GAT or GAC). Accordingly, when such a mutant protein is expressed and collected, it may be acid-treated to release the individual A chain, which itself is readily isolated to substantial purity and reconstituted in vitro with the B chain to provide a more natural protein. The use of the process herein results in increased yields of product with maximum cleavage specificity.
Of course, the utility of the present invention is not limited to use in connection with small and/or multi-chain peptides, and numerous other uses will become apparent to those of skill in light of the present specification. Figure 1 illustrates a comparison of the amino acid sequences of many of the currently known relaxin structures, with apparently conserved residues in boxes.

Figures 2A and B illustrate the protein and underlying DNA sequence of the H2 prorelaxin gene insert in plasmids pTrpProRelAsp (Figure 2A) and pTR411 (Figure 2B). Figure 3 illustrates diagrammatically the construction of plasmid pTrpProRel. Figure 4 illustrates diagrammatically the construction of plasmid pFEproH2. Figure 5 illustrates diagrammatically the construction of plasmid pTrpStϋProRel.
Figure 6 illustrates diagrammatically the construction of plasmid pTrpProRelAsp. Figure 7 illustrates diagrammatically the construction of plasmid pTR390-7. Figure 8 illustrates diagrammatically the construction of plasmid pTR400-20. Figure 9 illustrates diagrammatically the construction of plasmid pTR411 from fragments of pTR390-7, pTR400-20, and pTrpProRelAsp.
Figure 10 illustrates diagrammatically the construction of plasmid pTR540-2. Figure 11 illustrates diagrammatically the construction of plasmid pTR550-8. Figure 12 illustrates diagrammatically the construction of plasmid pTR561 from fragments of pTR540-2 and pTR550-8. Figure 13 illustrates diagrammatically the construction of plasmid pTR601 from fragments of pTR56I and pBR322.
Figure 14 illustrates diagrammatically the construction of plasmids pDH98 and pDH99.
Figure 15 illustrates diagrammatically the construction of plasmids pDHlOO and pDHIOl.
As used herein, the term “polypeptide” signifies a polypeptide having two or more polypeptide components that are to be cleaved, such as a fusion protein. Such polypeptides include certain proteins that are expressed by recombinant means only with some difficulty.
For example, certain proteins, and in particular, certain protein hormones, naturally exist in a mature form quite distinct from their cellular nascent form, requiring processing, often the action of a series of enzymes. Such proteins are said to exist in pre-, pro-, or prepro- forms, and include relaxin and insulin. Processing of such proteins generally results in the generation of two or more individual peptide chains (components), one or all of which may have biological activity, or which may themselves form bonds or crosslinks resulting in multi-chain proteins. In addition, the polypeptides herein have disulfide bonds when in an oxidized state. The preferred polypeptides herein are those that are not readily cleaved at the desired junction(s) between the components to be cleaved using a suitable cleaving agent, whether because of lack of access to the site of cleavage due to disulfide bonding, because of non-specific or auto-cleavage, or because of the amino acid environment surrounding the Asp residue. Also preferred are those polypeptides herein that contain multi-chains the internal sequence of which contains no cleavage site recognized or acted upon by the cleaving agent. For example, if the cleaving agent is acid, the polypeptide components (“cleavage products”) themselves are preferably free of aspartic acid (Asp) residues that would interfere with (i.e., adversely affect or prevent) the desired cleavage (or other residues that would potentially interfere such as asparagine residues). More

preferably, the components are free of internal Asp residues, and most preferably are completely devoid of Asp residues.
Numerous biologically active polypeptides that are devoid of Asp residues are known in the art. By way of illustration, proteins devoid of Asp residues include proteins such as growth-modulating peptide, eosinophilotactic factor, tuftsin, kinetensin, oxytocin, gonadoliberin, gonadotropin releasing hormone, neurotensin (bovine), bombesin, fibrinopeptide A (dog), motilin (pig), neutrophil chemotactic peptide, B-endorphin, alytesin, luteinizing hormone releasing hormone, somatostatin, substance P, litorin, thyrotropin releasing hormone, kallikrein, intrinsic factor – gastric juice, calcitonin (pig), alcohol dehydrogenase (IL stearothermoohilus). proinsulin (pig), and interferon gamma- induced protein precursor.
While the polypeptide to be cleaved is generally any polypeptide desired for this purpose, in one preferred embodiment the polypeptides targeted for acid cleavage contain an enhanced cleavage site as defined further below, and include precursor polypeptides, e.g., prepro-, pro- or pre- forms, or mutant precursor polypeptides containing enhanced cleavage sites. Among these, more preferred are prorelaxin, preprorelaxin, prerelaxin, proinsulin, preproinsulin, preinsulin, or biologically functional analogs thereof. Yet more preferred are human prepro- or prorelaxin. The most preferred polypeptide herein is H2 prorelaxin. For the H2 prorelaxin sequence, the most preferred sequence is that containing an A chain of 24 residues, a C chain of 108 residues, and a B chain of the first 29 amino acids, i.e., it is the form of relaxin found naturally in human serum and the corpus luteum.
As used herein, the term “relaxin” refers to one of the various forms of mammalian relaxin, or to a biologically functional analog of such relaxins. Relaxin and biologically functional analogs of relaxin thus refer to a functional protein that is effective to facilitate the birth process. Remodeling of the reproductive tract is understood to include such physiological actions as ripening of the cervix; thickening of the endometrium of the pregnant uterus, as well as increased vascularization to this area; and an effect on collagen synthesis. Relaxin has also been found in the female breasts and may be associated with lactation. Moreover, relaxin has been found in seminal fluid, suggesting a role in enhancing the mobility of spermatozoa. Also, given its effect on connective tissue, relaxin may play a role in improving skin elasticity.
Assays for relaxin “biological activity” are generally known in the art and include assays for smooth muscle or uterine contractility, for relaxation of the pubic symphysis, or for measuring cyclic AMP (see, e.g., EP Publ. No. 251,615 published Jan. 7, 1988). As used herein, the term “introduce” means the introduction into a DNA sequence of an additional codon or codons that include an Asp codon, or the alteration or mutation of an existing codon to provide an Asp codon. In this manner, a mutant protein is produced having a sequence that includes within its protein sequence the desired protein or peptide together with at least an additional Asp residue adjacent to either its amino terminus, carboxy terminus, or both. These mutant protein species may then be cleaved with mild acid treatment to release the desired protein.

As used herein, the term “reduced, free-cysteine form” refers to a form of the polypeptide that is in its reduced state, i.e., contains no disulfide bonding of cysteinyl residues that would interfere with the selective cleavage at the specific site desired, and also refers to a form that excludes the presence of other polypeptides that contain disulfide bonds, including dipeptides. For example, the prorelaxin is maintained in its reduced state without the presence of a dicysteinyl peptide with disulfide bridging. Such a peptide interferes with the cleavage even when the prorelaxin is maintained in the reduced state. Therefore, no such peptide can be present in the reaction mixture for treatment with the cleaving agent. For maintaining the polypeptide in its reduced form, thereby providing the polypeptide “under reducing conditions” as the term is used herein, any technique may be employed, including the addition of a reducing agent in a buffer containing the polypeptide, e.g., β-mercaptoethanol or the evacuation of the vessel containing the polypeptide. Dithiothreitol is contraindicated for this purpose. It is preferable, however, that the polypeptide be maintained under non-oxidizing atmospheric conditions, i.e., in the presence of a non-oxidant gas, e.g., an inert gas selected from helium, argon, neon, or krypton, or nitrogen.
As used herein, the term “cleaving agent” refers to a reagent used to cleave the polypeptide specifically so as to release its free components as desired. Suitable cleaving agents herein include enzymes, such as serine proteases, ubiquitin hydrolases, chromotrypsin, trypsin, staphylococcal protease, or subtilisin or its mutants, and chemical reagents, such as organic or inorganic acids, hydroxylamine, N-bromosuccinimide, and cyanogen bromide. Hydrolysis of peptide bonds catalyzed by a variety of proteolytic enzymes is taught in The Enzymes. 3rd Ed., Boyer, Ed., (Academic Press, Vol. Ill, 1971); Meth. Enzvmol.. Vol. XIX, Perlmann and Lorand, Ed. (New York: Academic Press, 1970); Meth. Enzvmol.. Vol. XLV, Lorand, Ed. (New York: Academic Press, 1976); Drapeau, J. Biol. Chem.. 253: 5899-5901 (1978) and Drapeau, Meth. Enzvmol.. 47: 89-91 (1977) For an extensive listing of chemical agents, see Witcop in Advances in Protein Chemistry, supra, including Table IQ on p. 226. In addition, Asp residues can be modified to induce trypsin cleavage, as taught by Wang and Young, Anal. Biochem.. 91; 696-699 (1978); and cleavage as taught by U.S. Pat. 4,769,326 issued Sept. 6, 1988 to Rutter may be employed. Other cleaving agents suitable herein will be recognized by the practitioner keeping in mind the desired junction for cleavage and whether the reagent can act on the reduced form of the polypeptide.
As used herein, the term “dilute acid” refers to an acid with a molar concentration that will depend on its pKa. The necessary concentration of acid is that which is sufficient to cleave a polypeptide at an Asp residue but not to cleave it at other residues where it is undesirable, and generally is such that a pH of between about 1 and about 3 is attained. Examples of suitable acids include both organic and inorganic acids such as citric acid, formic acid (for insoluble peptides), oxalic acid, acetic acid, sulfuric acid, and hydrochloric acid. Most preferred herein are acetic acid, hydrochloric acid, and sulfuric acid, most preferably acetic acid. In a typical protocol, the expressed protein is treated with acetic

acid on the order of between about 0.1 to 1.0 M for about 4 to 24 hours at about 90 to 120βC.
“Mildly hydrolytic conditions” refer to cleavage conditions that result in hydrolysis only of the desired peptide bond(s). Thus, the hydrolytic conditions must be commensurate with sufficient peptide bond cleavage at the desired site, and more preferably a pH of about 1 to 3 for acid cleavage at aspartic acid residues. 1. Introduction of Cleavage Recognition Codons into DNA Sequences
For the cleavage process, once a desired polypeptide is selected for production in accordance with this invention, it may be necessary to alter the gene sequence for the desired protein to introduce the codon(s) needed for recognition by the cleaving agent at an appropriate position or positions. Typically, where the desired polypeptide has no such residues within its sequence, it will be necessary to insert the appropriate codons either upstream and preferably adjacent to the 5′-terminal codon of the sequence encoding the desired polypeptide (where the carboxy terminus of the desired peptide is also the carboxy terminus of the expected translation product), downstream, and preferably adjacent the carboxy terminal codon of the desired component of the polypeptide (where the amino terminus of the desired polypeptide is also the amino terminus of the expected translation product), or both (where the desired polypeptide component to be isolated is an internal polypeptide of the expected translation product). Of course, where the expected translation product naturally includes an internal or terminal residue recognized by the cleaving agent, it will generally be necessary to introduce only one such codon coding for that residue, at a position upstream or downstream and adjacent the region to be isolated. Thus, for example, where a polypeptide component naturally includes an Asp residue within its amino-terminal region (i.e., the amino- terminal half) or within its carboxy-terminal region (i.e., the carboxy terminal half), it will generally be desirable to introduce an Asp residue upstream and adjacent the carboxy terminus or amino terminus, respectively, depending on the peptidyl region ultimately sought to be prepared.
Preferably, a cleavage site for recognition by the acid is a sequence that enhances the cleavage, such as the sequence Xn-Y-Asp, where X is any one of Ala, Ser, Glu, Pro, or Gly, X is Ala, Ser, or Gly, and n is greater than or equal to 0. Examples of such sequences include Ser-GIu- Ala-Ala- Asp, and conservative amino acid substitutions thereof, such as Ala-Glu-Ala-Ala-Asp, Ser-Glu-Ser-Ala-Asp, Ser-Glu-Ser-Ser-Asp, etc.
The sequence Ser-Glu-Ala-Ala-Asp was chosen for the example below because it represents an internal sequence of the C chain of human H2 relaxin that was found to be cleaved quite readily. Thus, in a preferred embodiment, a variant of precursor human H2 relaxin is prepared that has the four C-terminal amino acids of the C chain replaced with the codons encoding the sequence Ser-Glu-Ala-Ala- and the C chain connected to the A chain via an Asp residue. It will be understood, however, that the B and C chains of human relaxin are carrier polypeptides and that other polypeptides than those derived from

human prorelaxin can be attached to the human relaxin A chain via an enhanced acid cleavage site such as that described above.
In another preferred embodiment, several polypeptide chains (e.g., human relaxin A chains) are prepared simultaneously by constructing DNA encoding multiple (at least two) polypeptide cleavage product chains separated by Asp codons. Preferably such multiple chain segment has the sequence:
Xn-Y-Asp=(ppt)-[Asp-Xn-Y-Asp-(ppt)]m, wherein ppt is a polypeptide cleavage product (a polypeptide component resulting from cleavage of a desired peptide bond of the polypeptide), m is greater than or equal to 0, and n, X, and Y are defined above. Preferably, m is greater than or equal to 1, more preferably
2 or 3, and n is 0-10, and more preferably about 3. Also, preferably the polypeptide cleavage product is free of Asp residues, and is more preferably relaxin A chain, and most preferably human H2 relaxin A chain. Most preferably the chain segment has the sequence:
Ser-Glu-Ala-Ala-Asp-RlxA-[Asp-Pro-Ser-Ala-Asp-RlxA]m, wherein m is defined above, most preferably 2 or 3, and Rlx A is relaxin A chain, most preferably human H2 relaxin A chain.
Introduction of one or more particular codons into selected regions of a DNA sequence, whether by codon insertion or by altering existing codons, is readily achieved employing methods well known in the art. One such method is referred to as site-directed in vitro utagenesis (Boiler et al. (1982), Nucl. Acids Res.. 10: 6487-6500). In this method, a single-stranded template of the starting DNA sequence is prepared using the Ml 3 phage system. Then, short single-stranded primer sequence, generally about 12 to 100 nucleotides in length, is prepared synthetically (e.g., by the H-phosphonate method of Froehler et al. (1986), Nucl. Acids Res.. 14: 5399-5407). This synthetically prepared primer will include the sequence desired for the mutated DNA, that is, the primer encodes a DNA sequence complementary to the template but also including the desired codon(s) at the desired replacement point(s). After the primer is annealed to the template, the primer is extended using a DNA polymerase (e.g., E. coli DNA polymerase, Klenow fragment) to provide a double-stranded DNA molecule, with one strand bearing the original sequence and the other strand bearing the desired “mutated” sequence.
This construction is then employed to transform an appropriate Ml 3 host (e.g., E. coli JM101), in which certain offspring will bear the desired “mutated” sequence and certain offspring will bear the original starting sequence. Those offspring bearing the mutated sequence may then be selected by conventional techniques. The isolated construct may then be manipulated as desired to express the resultant mutant protein in an appropriate host.
Another method that may be employed to introduce the desired codon(s) is by simple restriction enzyme fragment replacement. For this approach, it is generally desirable to identify first a unique restriction fragment that spans the gene region to be altered. This is a conventional technique, requiring only knowledge of the location of restriction sites surrounding the sequence to be engineered. From the known DNA sequence, restriction sites are ascertained, most simply through the use of a computer program that compares the

sequence to a catalog of enzyme specificities. From the known restriction map, one must then identify a fragment that spans the DNA region where the desired codon(s) are to be inserted. Preferably, this fragment is “unique” in the sense that the remaining portion of the vector remains intact when the fragment is digested free of the vector. However, unique fragments of manageable length are often unavailable or not practicable. In such cases, one will generally desire to employ the fragment resulting in least vector fragmentation.
A corresponding replacement double-stranded DNA fragment bearing the original sequence but with the desired codon(s) introduced at an appropriate point is then prepared, generally synthetically. This replacement fragment bearing the mutant sequence is preferably prepared having appropriate restriction “sticky ends” (or blunt ends as the case may be), such that the mutant fragment may be readily annealed with the digested gene sequences so as to replace the excised portion. After the synthetic fragment is annealed with the vector fragment, thus effectively replacing the original fragment, appropriate host cells are transformed and selected.
Regardless of the method employed for the introduction of such residues, a mutated DNA sequence bearing the appropriate codon insertions is obtained, which sequence may then be expressed in an appropriate host, whether prokaryotic or eukaryotic. The vectors and method disclosed herein are suitable for use in host cells over a wide range of prokaryotic and eukaryotic organisms.
2. Exemplary Cloning Systems and Methodology a. Vectors and Hosts
In general, of course, prokaryotes are preferred for cloning of DNA sequences and for constructing the vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No. 31,446) and its derivative E. coli MM294tonA (resistant to Tl phage and obtained generally by transduction using the protocol described in EP 183,469 published June 4, 1986) is particularly useful. Other microbial strains that may be used include E. coli strains such as E. coli B and E. coli X1776 (ATCC No. 31,537). In the case of M13 phage cloning, the preferred host is generally E. coli JM101. Prokaryotes may also be used for expression. The aforementioned strains, as well as E. coli W3110 (F”‘ lambda, prototrophic, ATCC No. 27,325), bacilli such as Bacillus subtilus. and other enterobacteriaceae such as Salmonella tvphimuriu or Serratia marcesans. and various pseudomonas species may be used. These examples are, of course, intended to be illustrative rather than limiting, as numerous bacterial strains for expression and other purposes are well known and widely available to those of skill in the art.
In general, plasmid vectors containing replicon and control sequences that are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection in transformed cells. For example, E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species [Bolivar et al., Gene. 2:95 (1977)]. pBR322 contains genes for ampicillin and tetracycline resistance and thus

provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid, must also contain, or be modified to contain, promoters that can be used by the microbial organism for expression of its own proteins. Those promoters most commonly used in recombinant DNA construction include the beta-lactamase (penicillinase) and lactose promoter systems [Chang et al., Nature. 275: 615 (1978); Itakura et al., Science. 198: 1056 (1977); Goeddel et al., Nature. 281: 544 (1979)] and a tryptophan (trp) promoter system [Goeddel et al., Nucleic Acids Res.. 8:4057 (1980); EPO Appl. Publ. No. 36,776]. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling a skilled worker to ligate them functionally with plasmid vectors [Siebenlist et al., Cell. 20: 269 (1980)],
In addition to prokaryotes, eukaryotic microbes, such as yeast cultures, may also be used. Saccharomvces cerevisiae. or common baker’s yeast, is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. For expression in Saccharomvces. the plasmid YRp7 [Stinchcomb, et al., Nature. 282: 39 (1979); Kingsman et al., Gene. . 141 (1979); Tschemper et al., Gene. K): 157 (1980)], for example, is commonly used. This plasmid already contains the trβl gene that provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44,076 or PEP4-1 [Jones, Genetics. £5: 12 (1977)]. The presence of the trβl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
Suitable promoting sequences in yeast vectors include the promoters for 3- phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem.. 255: 2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg.. 2: 149 (1968); Holland et al., Biochemistry. 17: 4900 (1978)], such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphof ructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3′ of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination. Other promoters, which have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization (Holland, supra). Any plasmid vector containing yeast- compatible promoter, origin of replication, and termination sequences is suitable.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine

procedure in recent years [Tissue Culture. Academic Press, Kruse and Patterson, editors (1973)]. Examples of such useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI38, BHK, COS-7, and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences.
For use in mammalian cells, the control functions on the expression vectors are often provided by viral material. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment that also contains the SV40 viral origin of replication [Fiers et al., Nature. 273: 113 (1978)]. Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hindlll site toward the Bell site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.
An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., polyoma, adeno, VSV, BPV) source, or by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
Examples that are set forth hereinbelow describe use of E. coli using trp promoter systems. However, it would be well within the skill of the art to use analogous techniques to construct expression vectors for expression of desired protein sequences in alternative prokaryotic or eukaryotic host cell cultures. b. Exemplary Laboratory Techniques
If cells without formidable cell membrane barriers are used as host cells, transf ection is carried out by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology. ≤2: 546 (1978). However, other methods for introducing DNA into cells such as by nuclear injection or by protoplast fusion may also be used. If prokaryotic cells or cells that contain substantial cell wall constructions are used, the preferred method of transfection is calcium treatment using calcium chloride as described by Cohen et al., Proc. Natl. Acad. Sci. U.S.A., ££: 2110 (1972).
Construction of suitable vectors containing the desired coding and control sequences employs standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to prepare the plasmids required.
Cleavage of DNA is performed by treating with restriction enzyme (or enzymes) in suitable buffer. In general, about 1 μg plasmid or DNA fragments is used with about 1 unit of enzyme in about 20 μl of buffer solution. (Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer.) Incubation times of about one hour at 37°C are workable. After incubations, protein is removed by

extraction with phenol and chloroform, and the nucleic acid is recovered from the aqueous fraction by precipitation with ethanol.
If blunt ends are required, the preparation is treated for 15 minutes at 15°C with 10 units of Polymerase I (Klenow), phenol-chloroform extracted, and ethanol precipitated. Size separation of the cleaved fragments is performed using 6 percent polyacrylamide gel described by Goeddel et aL, Nucl. Acids. Res.. & 4057 (1980).
For ligation, approximately equimolar amounts of the desired components, suitably end-tailored to provide correct matching, are treated with about 10 units T4 DNA ligase per 0.5 μg DNA. (When cleaved vectors are used as components, it may be useful to prevent religation of the cleaved vector by pretreatment with bacterial alkaline phosphatase.)
For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures are used to transform E. coli K12 strain 294 (ATCC 31,446), or a derivative thereof, and successful transformants are selected by ampicillin or tetracycline resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction mapping, and/or sequenced by the method of Messing et al., Nucl. Acids Res.. £: 309 (1981) or by the method of Maxam et al., Meth. Enzvmol.. 65: 499 (1980). 3. Cleavage of Reduced Polypeptides
Whether or not the polypeptide is obtained by recombinant DNA technology, it is subjected to treatment with the appropriate cleaving agent. If the polypeptide is recombinantly expressed, as is preferred, it is preferably recovered from the host cell culture, as by lysing the cells and centrifuging them to obtain the appropriate fraction containing the polypeptide, and optionally purified from that fraction using techniques for recovering proteins from inclusion bodies, and placed in a buffer, before it is treated with the cleaving agent. In any event, for substantial increase in product yields, the polypeptide must be in reduced form before it is exposed to the cleaving agent, as shown by the accompanying examples. As mentioned above, the maintenance in reduced form is accomplished by any number of techniques, such as adding a reducing agent to the polypeptide and purging the container of oxygen before exposure to the cleaving agent as by purging with a non-oxidant gas such as argon, helium, or nitrogen.
The polypeptide is then treated with the cleaving agent under conditions resulting in the release of the desired peptide or peptides contained therein. Treatment will depend of course on the cleaving agent employed, and the conditions will be readily apparent to one skilled in the art given the cleaving agent employed. Examples of various cleaving agents and conditions associated with each can be found in Witkop in Advances in Protein Chemistry, supra.
Generally speaking, hydrolysis at Asp residues is achieved by heating the polypeptide for a period of time in dilute acid in accordance with the procedure of Schultz (1967), Methods Enzvmol.. U; 255-263; Light (1967), Methods Enzvmol.. JJL: 417-420. However, it may be appropriate to modify these conditions under certain circumstances, taking into consideration the partial pressure (presence) of oxygen, protein concentrations that might

range from about 0.1 to 1 mg/ml (higher amounts are deleterious to yields), the purity of the desired starting material, and potential chemical side reactions of a less desirable nature. Accordingly, depending on the protein being cleaved, acetic acid concentrations may range from about 0.1N to 1.0N, HC1 concentrations from about 0.01N to 0.1N, or sulfuric acid concentrations from about 0.001 to 0.1 N. Moreover, for acetic acid or HC1 incubation times will range from about 2 to 10 hours, and temperatures from about 90 to 120°C, and for sulfuric acid incubation times will range from 1-8 hours, and temperatures from about 85 to 130°C. More preferably, acetic acid concentrations will range from about 0.25 to about 0.75N (or HC1 from about 0.025N to about 0.05N, or sulfuric acid from about 0.003N to about 0.0 IN), with incubation times of about 4 to 8 hours for acetic acid and HC1 and of about 2 to 4 hours for sulfuric acid, at from about 100 to about 115βC. Most preferably, an acetic acid concentration of about 0.5N is chosen (or about 0.05N HC1 or about 0.005N sulfuric acid) with an incubation time of about 4 hours and an incubation temperature of about 110βC. In a typical protocol, found to work well in connection with the cleaving of mutant prorelaxin discussed below, samples of the expressed, relatively purified mutant protein are diafiltered into a urea buffer containing β-mercaptoethanol purged with helium or argon gas and diafiltered within 0-48 hours after the first diafiltration against acetic acid. After diafiltration, the sample is heated to about 110°C for about 2 to 10 hours, typically about 4-8 hours, at a protein concentration of about 0.25 to 1.0 mg/ml, and then the A chain is isolated and purified.
Purification of cleavage products is obtained by one of numerous peptide purification techniques, including, for example, gel or paper electrophoresis, chromatography, gradient centrifugation, and the like. It has been found that high performance liquid chromatography (HPLC) works particularly well in the separation and purification of acid- cleaved peptides. 4. Chain Combination
The relaxin chains can be combined using the method taught in EP Pub. No. 251,615, supra. Briefly, the application teaches a method of combining the A and B chains of human relaxin comprising mixing the reduced, free-cysteine form of the A chain and the reduced, free-cysteine form of the B chain in an aqueous medium having a pH of from about 7.0 to 12 under exposure to oxygen, under conditions whereby the B chain, but not the relaxin product, is denatured. 4. Formulation The human relaxin can be formulated using known methods to prepare pharmaceutically useful compositions such that the human relaxin is combined with a pharmaceutically acceptable carrier. Suitable vehicles and their formulation, including other necessary human proteins, e.g., human serum albumin, are described in standard formulation treatises, e.g., Remington’s Pharmaceutical Sciences by E.W. Martin. Preferably, the human relaxin is formulated as described in PCT Appln. Pub. WO 89/07945, published 8 September 1989. Briefly, for a liquid formulation useful particularly for

systemic administration, the relaxin is contained in an effective amount in a buffer capable of maintaining the pH of the composition at about 4 to below about 7. If the formulation is designed for topical applications, including intracervical or intravaginal application, the relaxin is conveniently provided in a gel format. Suitable vehicles for the gel include such agents as water-soluble polysaccharides such as, e.g., methylcellulose or polyethylene glycol. .If the gel is light sensitive, it must be stored under conditions that avoid exposure to light or in the presence of a proper stabilizer.
The examples that follow demonstrate the use of the present invention in connection with recombinant plasmids that encode relaxin proteins that are readily acid-cleaved to provide purified A chain protein. The methods employed herein are exemplary only. It will be apparent that various departures from and modifications of these techniques may be made in light of the present specification and the ordinary level of skill in the art without departing from the spirit and scope of the invention.
EXAMPLE 1 Construction of Recombinant Vectors That
Encode Asp-Inserted Human Prorelaxin A recombinant plasmid, designated pTR411, was constructed that encoded an Asp- inserted mutant of human H2 prorelaxin. This plasmid was prepared starting with a parental plasmid encoding H2 prorelaxin, designated pTrpProRelAsp, whose preparation proceeded through various intermediates. The end product of this genetic engineering was plasmid pTR411, which included the sequence of H2 prorelaxin DNA having an additional Asp codon inserted between the codons for amino acids Leu33 and Ser34, and Arg137 and Gln138. Both the protein and underlying DNA sequences of plasmids pTrpProRelAsp and pTR411 are displayed in Figures 2A and 2B, respectively. A. Preparation of Plasmid pTrpProRelAsp
The preparation of the parental plasmid, pTrpProRelAsp, proceeded through a number of intermediates, including first plasmid pTrpProRel followed by pTrpStllProRel. pTrpProRel is a plasmid that was constructed to include the Trp promoter and a methionine codon in front of a prorelaxin H2-encoding DNA sequence. pTrpStllProRel was constructed to include the StII leader sequence (U.S. Patent No. 4,680,262). pTrpProRelAsp was then prepared from pTrpStllProRel through the removal of the Stπ leader sequence and the first 11 amino acids of H2 prorelaxin (starting with Serx) and its replacement with a sequence encoding Met-AsPi followed by amino acids 2-12 of H2 prorelaxin. 1. pTrpProRel Referring to Figure 3, it can be seen that plasmid pTrpProRel was constructed in two steps. The first step introduced the Trp promoter and a methionine codon in front of the first half of the prorelaxin coding sequence, followed by adding on the back half of the prorelaxin gene.
The first step, as depicted in Figure 4, was accomplished by the ligation of the three fragments to form plasmid pFEproH2. The first of the three fragments, a blunt- end/BssHH fragment encoding amino acids 1 to 16 of Met prorelaxin, was prepared by

primer extension using a 350 basepair Pstl/Hoal fragment template isolated from the original cDNA clone (see, e.g., U.S. Pat. No. 4,758,516 and Hudson et al.. EMBO Jrnl. 1:2333 – 2339 (1984)).
Briefly, the original cDNA clone was isolated as follows: Samples of human corpus luteum were made available as a result of surgical intervention in ectopic pregnancies or from lutectomy at the time of Caesarian section. From the RNA isolated from a single corpus luteum a cDNA library was constructed in pBR322 providing about 300 unique recombinant plasmids. This library was screened with an Hl-cDNA probe corresponding to a 400 nucleotide segment coding for the C- and A-chains from amino acid 64 through the termination codon and including 80 bases of the 3′ untranslated region. A single positive cDNA clone from the pBR322 library was isolated and sequenced and found to have sequence homology to human relaxin HI. The total number of recombinant clones from such small amounts of ovarian tissue was increased by constructing cDNA libraries using the lambda-GTIO cloning system. Screening with a relaxin-specific probe identified 23 unique cDNA clones of which six were characterized as shown in Fig. 1 of U.S.
4,758,516. Nucleotide sequence analysis revealed that all six cDNA recombinant clones encoded fragments of the same relaxin structural gene, yet this sequence was different from that of the genomic HI clone.
The cDNA clone shown in Fig. 1 of U.S. 4,758,516 and identified as a, b, or c was digested with Pstl and Hpal. The resulting Pstl/Hpal fragment and the 15-mer primer 5′-
ATGTCATGGATGGAG, which encoded the amino acids Met-Ser-Trp-Met-Glu, were employed in a primer repair reaction (see, e.g., U.S. Patent No. 4,663,283) to create the blunt-end /BssHII fragment.
The second piece was a 410 basepair BssHII/Bglll fragment containing codons 17 to 153 of prorelaxin isolated from the original cD A clone shwon in Fig. 1 of U.S. 4,758,516.
The third piece was a cloning vehicle that was prepared from plasmid pHGH207- 1*L by treating it with EcoRI. DNA polymerase (Klenow fragment) and then Belli. [pHGH 207- 1*L is identical to pHGH207 (U.S. Patent No. 4,663,283), except that the EcoRI site upstream of the Trp promoter had been removed by EcoRI digestion and blunting with DNA polymerase Klenow.] This removed a 420 basepair fragment encoding the first 137 amino acids of metHGH, leaving the cloning vector intact. This fragment included resistance genes for ampicillin and tetracycline.
The ligation mixture was used to transform E. coli K12 strain 294. Colonies were selected for ampicillin resistance and screened by colony hybridization using the 15-mer disclosed above. Positive clones were identified by Ml 3 dideoxy sequencing.
As shown in Figure 3, the second step results in the formation of plasmid pTrpProRel. For this construction, a three-piece ligation was employed. The first segment was a 1510 basepair Pstl/Bglll fragment from pFEproH2 that contained the amino- terminal half of the H2 prorelaxin coding sequence. The second was a 100 basepair Avall/B iπ fragment from the original cDNA clone (Hudson et al.. supra) in which the Avail site had been blunted by treatment with DNA polymerase (Klenow). This fragment

contained the last 6 codons of prorelaxin. The third was pBR322XAP that had been treated with EcoRI. DNA polymerase (Klenow) and Pstl to remove the 750 basepair fragment encoding the front half of the β-lactamase gene [pBR322XAP is a derivative of pBR322 in which the 640 basepair Aval/PvuII fragment has been removed.] The ligation mixture was used to transform E. coli strain 294, and colonies were selected by tetracycline resistance and screened by restriction analysis.
2. PTrpStllProRel
The plasmid pTrpStllProRel was an intermediate in the construction of pTrpProRelAsp. As shown in Figure 5, pTrpStllProRel was constructed in two steps, the first of which involved Ml 3 site-directed mutagenesis wherein the prorelaxin coding sequence was fused precisely to that of the Stll signal sequence. This was accomplished by ligating a 950 basepair Xbal/BamHI fragment from pTrpProRel in which the Xbal site had been blunted with DNA polymerase (Klenow) into an Ml 3 phage vector containing the Stll signal sequence with an Xbal site just upstream of the ATG codon. The Ml 3 vector was previously treated with Bglll, DNA polymerase (Klenow), and then BamHI. Standard procedures were then followed for site-directed mutagenesis (see, e.g., Adelman et al. (1983), DNA. 2:183).
After identification of the correct MI 3 clone, the 1020 basepair Xbal/BamHI fragment encoding the Stll signal sequence fused precisely to the prorelaxin gene was excised and ligated into a vector identical to pTrpStllHGH (U.S. Patent No. 4,680,262) in which the 1000 basepair Xbal/BamHI fragment encoding the HGH gene had been removed.
3. pTrpProRelAsp
Referring to Figure 6, it can be seen that plasmid pTrpProRelAsp was prepared from plasmid pTrpStllProRel through the removal of a 105 basepair Xbal/Notl fragment containing the Stπ sequence and the first 11 amino acids of H2 prorelaxin. This fragment was replaced with the following synthetically produced DNA duplex:
5′-CTAGAATTATGGACTCTTGGATGGAAGAAGTTATCAAACTGTGC
TTAATACCTGAGAACCTACCTTCTTCAATAGTTTGACACGCCGG-5« As will be appreciated, this synthetic sequence encoded the first 12 amino acids of
H2 prorelaxin (including Asp! of prorelaxin).
This construction was used to transform E. coli strain 294, and colonies were selected by tetracycline resistance.
B. Preparation of Plasmid PTR411 Plasmid pTR411 was constructed from three plasmids in all, the parental plasmid pTrpProRelAsp and two plasmids, pTR390-7 and pTR400-20, designed to provide Asp- codon-engineered replacement fragments for the regions spanning the B/C and C/A interface, respectively. The overall scheme employed in the construction of plasmid pTR411 is shown in Figure 9. 1. PTR390-7
Plasmid pTR390-7 was designed to introduce an Asp codon in the Met-prorelaxin gene between the end of the B-chain encoding and start of the C-chain encoding DNA

sequences. As can be seen in Figure 7, plasmid pTR390-7 was constructed by the ligation of four fragments, the first of which was simply a cloning vector (pPA781; see below) in which a nonessential EcoRI-Bglll fragment had been removed. The insert for this cloning vector was comprised of three fragments. The first was an 80-basepair EcoRI-HgiAI fragment from pTR31 which contained the first 27 codons of Met-prorelaxin. pTR31 is a derivative of pTrpProRelAsp in which the 40 basepair Xbal/Notl fragment had been replaced with the synthetic DNA duplex:
5′-CTAGAATTCTATGGACAGTTGGATGGAAGAAGTGATCAAGTTGTGT
TTAAGATACCTGTCAACCTACCTTCTTCACTAGTTCAACACACCGG-5′ .
The second fragment was a 360 basepair SfaNI-Bglll fragment, also from pTR31, which contained codons 34-155 of Met-prorelaxin, and the third fragment a synthetic DNA duplex having the sequence:
5′-CCTGGAGCAAAAGGTCTCTGGAT TCGTGGACCTCGTTTTCCAGAGACCTATCGG-5•
As will be appreciated, the above sequence encodes amino acids 28 through 33 of prorelaxin followed by the Asp codon GAT. This synthetic fragment was prepared generally by the triester method (Crea et al.. supra). [pPA781 is a derivative of the plasmid JH101 (Jrnl. Bacteriol.. 154: 1513-1515
(1983)). The 29 basepair EcoRI-Hindlll fragment from this plasmid had been replaced with an 810 basepair DNA fragment containing the Pac promoter (Proc. Natl. Acad. Sci. USA. 8L: 439-443 (1984)). Bacillus amyloliαuifaciens aloha-amvlase signal sequence (Gene. 15: 43-51 (1981)), and the human growth hormone gene (Nature. 281: 544-548 (1979)).] The four fragments were ligated together and used to transform E. coli cells.
Transformants were selected on ampicillin and the plasmid pTR390-7 was selected by restriction analysis and dideoxy sequencing. 2. PTR400-20 Plasmid pTR400-20 was designed to introduce an Asp codon in the Met-prorelaxin gene between the end of the C-chain (Arg137) and beginning of the A-chain (Gln138) encoding regions. As can be seen in Figure 8, this plasmid was constructed by ligating together three fragments. As with pTR390-7, the first fragment was simply a cloning vector (pPA781) in which the nonessential EcoRI-Bglll fragment had been removed. The second fragment was a 405 basepair EcoRI-Taαl fragment containing codons 1-134 of Met- prorelaxin obtained from plasmid pTR31 by EcoRI-Taαl digestion. The third piece was a synthetic DNA duplex, synthesized in the manner discussed above, and having the sequence:
5′-CGAAAAAAGAGAGATCAACTCTACAGTGCATTGGCTAATAAATGTTGCCATGTTGG- TTTTTTCTCTCTAGTTGAGATGTCACGTAACCGATTATTTACAACGGTACAACC- TTGTACCAAAA
AACATGGTTTTCTAG-5■

As will be appreciated, the above synthetic fragment encodes amino acids 135-154 of Met- prorelaxin, with the addition of an Asp codon (GAT) between amino acid codon 137 (AGA) and 138 (CAA).
The three fragments were ligated together and used to transform E. coli KI2 strain 294 cells. Transformants were selected by ampicillin resistance and plasmid pTR400-20 was selected by restriction analysis and subjected to dϊdeoxy sequencing. 3. PTR411
Referring to Figure 9, plasmid pTR411 was constructed by ligating together three pieces of DNA. The first piece was plasmid pTrpProRelAsp in which the 410 basepair BssHH-Bgiπ fragment had been removed. This linearized plasmid therefore contained codons for amino acids 1-18 and 156-161 of prorelaxin. The second piece was a 235 basepair BssHH-Hinfl fragment from pTR390-7 that contained the codons for amino acids 19-97, with an additional Asp codon between the codons for amino acids 33 (leu) and 34 (ser). The third piece was a 175 basepair Hinfl-BgHI fragment from pTR400-20 that contained codons 99-155 of met-prorelaxin, with an extra Asp codon between the codons for amino acid 137 (arg) and 138 (gin).
After ligation of the three fragments, the mixture was employed to transform E. coli K12 strain 294 cells. Transformants were selected by ampicillin resistance, and plasmid pTR411 was selected by restriction analysis. EXAMPLE 2
Construction of Recombinant Vectors That Encode Asp-Inserted Human Prorelaxin With Enhanced Acid Cleavage Site The plasmid pTR601 (Fig. 13) is a derivative of pTR411 (Fig. 9) in which the prorelaxin encoding sequence has been changed to produce a protein with an enhanced acid cleavage site preceding the relaxin A chain. Codons for amino acids ArgLysLysArgAsp just preceding the A chain in pTR411 are changed to codons for SerGluAlaAlaAsp in pTR601. In addition, the Asp codons at positions 99, 120, and 132 have been changed to Glu codons. The construction of pTR601 required four steps, detailed below, resulting in the intermediate plasmids pTR540-2, pTR550-8, and pTR561. Preparation of pTR540-2 (Fig. 10)
The plasmid pTR540-2 was constructed from three DNA fragments, the first of which was the vector pHGH207-l (U.S. Pat. 4,663,283) in which the small Xbal-BamHI fragment had been removed. The second was a 285-bp Xbal-Rsal fragment isolated from pTR411 encoding the first 94 amino acids of Asp-inserted prorelaxin. The third was the 76-bp synthetic DNA duplex RelXXII of the sequence:
5»-ACC GTATTAAAAGAATCCAGTCTTCTCTTTGAAGAATTTAAGAAACTTATTCG- 3′-TGGACATAATTTTCTTAGGTCAGAAGAGAAACTTCTTAAATTCTTTGi^ATAAGC-
CAATAGACAAAGTGAAGCCGCG-3» GTTATCTGTTTCACTTCGGCGCCTAG-5•
The three fragments were ligated together using T4 ligase and used to transform coli cells. Transformants were selected on ampicillin plates and the plasmid pTR540-2 was

selected by restriction analysis and DNA sequencing. The scheme for its preparation is shown in Fig. 10.
Preparation of pTR550-8 (Fig. 11)
The plasmid pTR550-8 was prepared from three DNA fragments, the first of which was isolated from the cloning vector pTIl l containing available EcoRI and Hindlll restriction sites and treated with EcoRI and Hindlll. The vector pTIl 1 is a derivative of pHGH207-l in which the human growth hormone-encoding sequence has been replaced by that for human interleukin-1. An alternative vector for this construction is the vector fragment isolated from pBR322 digested with EcoRI and Hindlll. The second fragment was the 65-bp synthetic duplex RelXXIII of the sequence:
5»-AATTCCGCGGAAAGCAGTCCTTCAGAATTAAAATACTTAGGCTTGGAAACTCAT- 3»- GCGCCTTTCGTCAGGAAGTCTTAATTTTATGAATCCGAACCTTTGAGTA- TCTTCAGAGGCAGCT-3′
AGAAGTCTCCGTCGACTAG-5’
The third part was the 183-bp Sau3AI-HindIII fragment from pTR411 encoding amino acids 140-164 of Asp-inserted prorelaxin. This last fragment was obtained by first isolating the 306-bp HinFI-Hindlll fragment from pTR411 and then partially digesting this fragment with Sau3AI.
The three fragments were ligated together and the mixture was used to transform E. coli strain 294. Transformants were selected for ampicillin resistance and the plasmid pTR550-8 was selected by restriction analysis and DNA sequencing. The scheme for preparing TR550-8 is shown in Fig. 11. Preparation of PTR561 (Fig. 12)
The plasmid pTR561 combines all of the coding sequence for Asp-inserted prorelaxin with the enhanced acid cleavage site. Three DNA fragments were used in the construction, the first of which was the vector pTR411 in which the small BssHII-BamHI fragment had been removed. The second was the 297-bp BssHII-SacII fragment obtained from pTR540- 2. The third was the 900-bp SacII-BamHI fragment obtained from pTR550-8 encoding the last 45 amino acids of the enhanced Asp-inserted prorelaxin. This last fragment also contains some interleukin-1 sequence between the Hindlll and BamHI sites that is not important for the construction. The three fragments were ligated together with T4 ligase and used to transform E. coli strain 294 cells. Transformants were selected for ampicillin resistance and the plasmid pTR561 was selected by restriction analysis. The scheme for construction of pTR561 is shown in Fig. 12. Preparation of PTR601 (Fie. 13) The final plasmid pTR601 removes all nonessential interleukin-1 sequence from pTR561 and restores the tetracycline resistance gene. Three fragments were used to construct pTR601, the first of which was the vector pTR561 in which the small BglH- BamHI fragment had been removed. This vector was then treated with bacterial alkaline

phosphatase to prevent its recircularization. The second was a 26-bp Bglll-Alul fragment obtained from pTR561 and encoding the last six amino acids of prorelaxin. The third was the 377-bp EcoRI-BamHI fragment from pBR322 in which the EcfiRI site had been filled in with DNA polymerase Klenow. The three fragments were ligated together and used to transform E. coli 294 cells.
Transformants were selected for tetracycline resistance and the plasmid pTR601 was selected by restriction analysis. The scheme for the construction of pTR601 is shown in Fig. 13.
EXAMPLE 3 Expression of Gene Encoding, and Cleavage of, Asp-Inserted
Human Prorelaxin With Enhanced Acid Cleavage Site The plasmid pTR601 described in Example 2 was used to transform the host cell W31 lOtonA using the protocol described below. E. coli W3110 ton A host is a strain that is essentially resistant to TI phage and constructed using standard laboratory techniques involving transductions with phage derived from PI (see, e.g., J. Miller, Experiments in Molecular Genetics. Cold Spring Harbor Press: New York, 1972). This host was generally obtained as described in EP 183,469 published June 4, 1986.
Approximately 25 ml of LB broth was inoculated with a single colony of W31 lOtonA host cells. This mixture was incubated until an A550 of approximately 1.0 was obtained. This incubation mixture was then transferred to a chilled contrifuge tube and placed on ice for about 5 to 10 minutes, then centrifuged at 600 rpm for 5 minutes. The pellet was then resuspended in 8.0 ml. of ice cold 0.1 M CaCl2, vortexed, and allowed to sit on ice for 4 hours. After this time, the mixture was centrifuged at 6,000 rpm for 5 min., and the pellet resuspended in 1.0 ml. of 0.1 M CaCl2 in 15% glycerol. The suspension was allowed to sit on ice overnight.
For transformation, approximately 0.25 to 0.5 ng of pTR601 plasmid DNA was added to 50 μl of CaCl2-treated competent cells and the mixture allowed to sit on ice for I hour. After heat shocking at 42°C for 90 seconds, the mixture was transferred to ice for one minute after which 0.1 ml of LB broth was added. After a 1-hour incubation period at 37°C the mixture was plated on LB agar plates containing 20 μg of tetracycline/ml. Frozen stock cultures were made from single colony in LB medium with 5μg tetracycline/ml that had been grown to an A550 of about 1.0 at 37°C. Cultures were frozen in 10% DMSO at -70βC.
For culture of the transformed cells, 500 ml of LB broth was inoculated with 0.5 ml of the frozen stock culture and incubated at 37βC and 200 rpm for 8 hours. The seed culture thus obtained was placed in a 10-liter fermenter to which Trp 8 salts were added. Trp 8 salts consist of 5.0 g/L of ammonium sulfate, 6.0 g/L of K2HPO4, 3.0 g/L of NaH2PO4, and 1 g/L of sodium citrate.2H2O. The Trp 8 salts (10 L) were sterilized in the fermenter in 7 liters of distilled water. After the fermenter had cooled, the following ingredients were added: 500 ml of 50% glucose, 100 ml of 1 M MgSO4, 5 ml of trace metals

with iron, 5 ml of 2.7% FeCl3, 250 ml of 20% Hycase, 250 ml of 20% yeast extract, and 10 ml of 5 mg/ml tetracycline.
The culture was grown at 37°C, pH 7.0, with aeration at 10 1pm, agitation at 1000 rpm, and back pressure at 0.3 bar. A slow feed of glucose was initiated at about 00550^ of 20. A total of 25 ml of a 25 mg/ml solution of 3-indole acrylic acid (IAA) was added at 00550^ of 30. The culture was harvested 8 hours after the addition of IAA. The cell pellet was collected via Sorvall R3CB and frozen at -20°C.
The Asp-inserted mutant human prorelaxin from pTR601 was purified from the cell paste as follows: Cell paste from pTR601 -transformed cells was processed by suspending it in lysis buffer (20 mM TrisHCl pH 8, 500 mM NaCl, 10 mM EDTA) in a 1:10 ratio. The suspension was passed through a Manton-Gaulin homogenizer at about 6,000 psi, three times. After centrifugation at 6000xg for 30 minutes, the pellet was solubilized into 4 M guanidine-
HC1/20 mM Tris-HCl pH 8/0.1% β-mercaptoethanol (BME). This solution was ultrafiltered and diafiltered into 20 mM NH4 acetate buffer, pH 4.5, 6 M urea/0.1 % BME. This material was loaded into a sulfopropyl-trisacryl (SPTA) column (LKB Produkter).
SPTA fractionation was undertaken in order to achieve an initial purification of the mutant Asp-inserted prorelaxin. The column dimensions were about 10 x 12 cm, which correspond to about a 950 ml bed volume. The buffer employed was 25 mM NH4 acetate/6 M urea/0.1% BME. The flow rate employed was about 30 ml/min, which was equal to about 1.8 liters per hour. A 5 column volume gradient of 0-0.65 M NaCl in column buffer was employed. In a typical fractionation run, approximately 1 kilogram of cell paste was fractionated for every 2.5 liters of resin.
SDS-polyacrylamide gel electrophoresis (15%) was performed on various fractions to determine pooling parameters. Pools containing the mutant Asp-inserted human prorelaxin protein were ultrafiltered/diafiltered into 4M guanidine-Cl/20 mM Tris-HCl, pH 8.0/0.1%
BME and loaded onto a Sephacryl-300 column in the same buffer.
The Sephacryl-300 column employed had dimensions of 5.0 x 90 cm (a 1.7 liter bed volume), with a flow rate of about 100 ml/hr. Generally, a ratio of resin/paste of 14 L/kg paste was employed. Again, SDS polyacrylamide gel electrophoresis was performed on column fractions to determine pooling parameters.
The pools containing essentially purified mutant Asp-inserted Met-prorelaxin were collected and diafiltered using 4 volumes of 7.5M urea and 0.1% BME and then diafiltered using 20 volumes of 0.5N acetic acid. The second diafiltration step was conducted in the absence of oxygen by purging the reaction vessel with helium gas to maintain the prorelaxin in a reduced form.
Enhanced acid cleavage was performed under the following conditions: a protein concentration of about 1 mg/ml and incubation at 110°C for 4 hours without evacuation of the reaction vessel. Then the hydrolysate was dried down in a rotary evaporator and dissolved in buffer with 4M urea, 20 mM Tris, and 100 mM DTT, pH8 and the solution was loaded on a S-Sepharose Fast Flow column equilibrated in the same buffer. The A

chain adhered to the column and a gradient of sodium chloride was used to elute the A chain. The A chain pool was exchanged into 0.5N acetic acid on a G25 gel filtration resin and dried in a rotary evaporator. Then the A chain was dissolved in 4 M guanidine-Cl, 20 mM Tris HCl, pH 8, and 100 mM DTT. Finally, the samples were purified preparatively by HPLC as described below.
HPLC was performed on a Vydac C-4 reverse phase column under the following conditions:
Vydac C-4 RPC (4.6 x 250 mm, 300A, 5μ)
0.1% TFA/water 0.1% TFA/acetonitrile
15-55% gradient
0.5% per minute, 2 ml per minute
280nm-AUFS 0.02; 214nm-AUFS 0.1
0.2cm per minute chart speed As will be appreciated, three main peaks were obtained, designated peaks 1, 2, and
3, respectively. Fractions corresponding to peaks 1, 2, and 3 were collected and sequenced and amino acid compositions determined. The peptide from peak 1 was found to contain sequences corresponding to cleavage fragments from the C peptide region of prorelaxin. The peptide from peak 2 was found to have no apparent sequence, because the N-terminal glutamine had cyclized to the pyro-glutamic acid form, which does not respond to Edman degradation. The peak 2 peptide was determined to be A chain upon amino acid composition analysis and mass spectrometry. The peptide from peak 3 was found to correspond to des(Asp1)-B chain.
The approximate elution position of the three peptides was as follows: pyroGlu A chain (peptide 2) eluted at an apparent acetonitrile concentration of about 26.0% and des(Asp1) B chain eluted at an apparent acetonitrile concentration of about 43.6%.
The approximate recovery of A chain peptide, based on the mass of A chain, relative to the amount present in the starting Met-Asp-inserted prorelaxin in the acetic acid cleavage protocol, was found to be about 38-42%. The identical experiment without the helium purge during the second diafiltration step resulted in a yield of 27%.
Samples containing the column-purified A chain material were stored at -20″ C until used.
Comparative experiments using pTR411 as the expression vector were performed repeating the above protocol except that the cleavage was performed as follows: Freshly purified samples from the Sephacryl-300 column were dialyzed overnight against about 100 volumes of 0.5 M acetic acid. Cleavage was ‘ performed under the following conditions: a protein concentration in the range of about 0.25 to 2.0 mg/ml was typically employed. The samples were incubated at 110°C for 18 hrs., and evacuated to final conditions of approximately 2 torr. Samples were then stored at -20° C until analyzed or preparatively collected by HPLC.

Under the above conditions, the approximate recovery of A chain peptide obtained, based on the mass of A chain relative to the amount present in the starting Met-Asp- inserted prorelaxin in the acetic acid cleavage protocol, was originally thought to be approximately 40-50% for the pGlu-A-chain. When the experiment was repeated several times and the products were analyzed more fully by HPLC and mass spectroscopy, it was found that what was thought to be the A chain was an extended A chain and that the recovery of A chain was between approximately 5 and 10%. When the experiment was repeated by alternate purge cycles of helium gas followed by evacuation, the yields of relaxin A chain did not significantly improve. It was found that the yield of A chain from the enhanced Asp cleavage prorelaxin
(from pTR601) varied dramatically depending on several parameters described below.
The. optimal cleavage time for 0.5N acetic acid at 110°C was found to be about 2 to 10 hours, most optimally about 4-8 hours.
When the enhanced acid cleavage experiment was repeated using relaxin A prepared by the Merrifield peptide synthesis rather than recombinant relaxin A, about 50% of the recoverable protein was degraded. Some of the primary sites of hydrolysis appeared to be cysteine residues, and, to a lesser degree, serine residues.
When the enhanced acid cleavage experiment was repeated except that 0.001-0.003 N trifluoroacetic acid, 0.005 N sulfuric acid, or 0.03-0.05N hydrochloric acid was employed, it was found that of all the acids tested, 5mM sulfuric acid and 0.5N acetic acid gave the best yields.
When the enhanced acid cleavage experiment was repeated except that prorelaxin concentration was increased from 1 mg/ml to 19 mg/ml, it was found that the HPLC C4 peak for A chain decreased from about 9 cm at about 1 mg/ml to 6.4 cm at 8 mg/ml to 5.6 cm at about 19 mg/ml.
When the enhanced acid cleavage experiment was repeated except that 1-10 mM dithiothreitol (DTT) was used instead of BME in the first diafiltration step, the yield of A chain decreased substantially.
When the enhanced acid cleavage experiment was repeated except that 1 and 10 mM oxidized cysteine (cystine) was added to the acetic acid hydrolysis mixture, the yield of A chain decreased markedly.
When the enhanced acid cleavage experiment was repeated except that after the first dialysis, the samples of prorelaxin were allowed to stand in the urea/BME dialysis buffer for periods greater than three days before being dialyzed using the acetic acid, the yield of A chain was reduced to 24-25%. A suitable time to initiate cleavage after reducing conditions are imposed would be 0 to 2 days, preferably 0-24 hours, most preferably immediately. These experiments suggest that the formation of disulfide bonds in the molecule should be avoided to obtain maximum yields from the hydrolysis reaction. Further, these results show that, unexpectedly, disulfide bonds can be formed under acid conditions, which are not conducive therefor.

The sample containing the HPLC-purif ied A chain can be used to reconstitute relaxin as described in Example 4.
EXAMPLE 4
Reconstitution of Relaxin Employing Relaxin Peptides
The following protocol(s) can be employed in order to reconstitute relaxin using purified A chain obtained as above.
Method I: Refolding is performed in a total volume of about 1142.5 μl, composed as follows: 100 μl of 0.5 M glycine (BioRad Laboratories), pH 10.5, 100 μl 6 M urea (Malliπckrodt), 725 μl water, 50 μl acetonitrile (Burdick and Jackson), 15 μl 1-propanol
(Burdick and Jackson), 100 μl of A chain solution (3 mg/ml relaxin A chain in water) and
62.5 μl of B chain solution (504 μg relaxin B chain in 350 μl 6 M urea). The samples are refolded overnight at 20°C with gentle mixing.
Method II: Refolding is performed in a mixture composed as follows: 0.2-1 M CAPS buffer (3-[cyclohexylamino]propanesulfonic acid, CalBioChem), pH 10.2, 0.75 M guanidine hydrochloride, 10% (v/v) methanol (Burdick and Jackson), and a range of total protein concentration from 0.25 to 2.0 mg/ml. The protein ratio of relaxin A chain to relaxin B chain should be on the order of about 4 parts A chain and 1 part B chain. The solution should be thoroughly purged with an inert gas such as N2 or argon and stirred overnight in the presence of air (12-18 hrs.) at 20βC.
All folded samples may be assayed for activity and/or repurif ied by HPLC essentially as previously described (Example 3).
Large-scale refolding is obtained by increasing the overall amounts of materials proportionally. EXAMPLE 5
Construction and Expression of Genes Encoding, and Cleavage of,
Asp-Inserted Polymeric A Chain Human Prorelaxin Mutants
The generation of polymeric forms of A-chain to improve expression using acetic acid cleavage to hydrolyze the polymer was investigated in this example. Four plasmids were constructed that had three or four relaxin A chains together that were linked with the sequence:
-Glu- Ala-Ala- Asp-RlxA-[Asp-Pro-Ser- Ala- Asp-RlxA]2.3, or
-Glu-Ala-Ala-Asp-RlxA-[Asp-Gly-Ser-Ala-Asp-RlxA]2.3, where RlxA is relaxin A chain. The constructions of these plasmids are detailed below and in Figures 14 and 15, respectively. Two intermediate plasmids pRP12 and pRP34 linking the back end of the A chain through the appropriate linker to the front end of the A chain were prepared as follows: Synthetic oligonucleotide linkers of the following sequence were prepared by phosphoramide synthesis:
RP1 5*-AATTGGATCCCTTGCTAGATTTTGCGATCCTTCAGCA-3 ‘ RP2 3′- CCTAGGGAACGATCTAAAACGCTAGGAAGTCGTCTAG-51

RP3 5»-AATTGGATCCCTTGCTAGATTTTGCGATGGTTCAGCA-3 • RP4 3«- CCTAGGGAACGATCTAAAACGCTACCAAGTCGTCTAG-5’ <—C terminus of A—><--linker—> The next piece was a partial Sau3A-HindIII fragment from pTR411 (Fig. 9) that contains the entire relaxin A chain and places the last Asp of the linkers shown above in front of the first amino acid of relaxin. Fragment from pTR411: 5•-GATCAACTCT ACAGTGCATT GGCTAATAAA TGTTGCCATG TTGGTTGTAC
3′- TTGAGA TGTCACGTAA CCGATTATTT ACAACGGTAC AACCAACATG
GlnLeuT yrSerAlaLe uAlaAsnLys CysCysHisV alGlyCysTh
CAAAAGATCT CTTGCTAGAT TTTGCTGAGA TGAAGCTAAT TGTGCACATC GTTTTCTAGA GAACGATCTA AAACGACTCT ACTTCGATΪA ACACGTGTAG rLysArgSer LeuAlaArgP heCysOP*
TCGTATAATA TTCACACATA TTCTTAATGA CATTTCACTG ATGCTTCTAT AGCATATTAT AAGTGTGTAT AAGAATTACT GTAAAGTGAC TACGAAGATA
CAGGTAATTC TCATGTTTGA CAGCTTATCA TCGATA-3• GTCCATTAAG AGTACAAACT GTCGAATAGT AGCTATTCGA-5′
Two ligations were employed using T4 ligase and the components: pRP12: RPl plus RP2 plus pTR411 fragment plus EfioRI-Hindlll vector fragment of pBR322; and pRP34: RP3 plus RP4 plus pTR411 fragment plus EcoRI-Hindlll vector fragment of pBR322.
Strain MM294tonA (prepared by a standard transduction method generally as described in EP 183,469 published June 4, 1986) was transformed with each of the above plasmids using a standard E. coli transformation protocol. Miniscreen restriction analysis and sequencing were done to confirm that the correct sequence was obtained. From each of these plasmids a BgHI-BamHI digestion will release a fragment that contains the back end of the A chain, the appropriate linker fragment, and the front end of the A chain. The expression plasmid pTR601 was digested with Belli, which cuts once in the plasmid in the A chain coding region, and then treated with bacterial alkaline phosphatase to reduce religation of the vector.
Both pRP12 and pRP34 were individually digested with Bglll and BamHI and the approximately 90-bp fragments were isolated from acrylamide gels. These fragments were self-ligated to form polymers, which could go together in a variety of ways, represented below: digestion — > — > –> < > –> <-- < > — > <« with Belli - - + + - + - + - + and BamHI trimer mon. dimer dimer dimer monomer where mon. is monomer and — > is Bam to Bgl and <-- is Bgl to Bam. Subsequent digestion with Belli and BamHI should only leave head tail polymers, as those junctions are resistant cleavage both enzymes. After this digestion, the DNA was run on an acrylamide gel dimer bands of approximately 180 trimer 270 were eluted from gel, separately for pRP12 pRP34 fragments. These fragments ligated into pTR601 vector fragment described above resulting construct transformed strain MM294tonA above. Transformants analyzed by miniscreen restriction analysis correct plasmids. Four plasmids isolated outlined below: No. Name A chains Figure Linker pDH98 3 14 AspProSerAlaAsp pDH99 4 pDHlOO 15 AspGlySerAlaAsp pDHlOl AspGlySerAlaAsp Each these used transform W31 lOtonA cells cell cultures grown up using conditions -transformed cells. Each expressed a protein expected molecular weight. The E. coli fermenter pastes stored at -80βC. 1 g paste suspended in 10 volumes ice-cold suspension buffer (25 mM Tris HCl, 5 EDTA, DTT pH 7.5 25βC) sonicated min. Ultrasonics sonicator Microtip probe power setting 6 40% duty cycle, cooling immersion ice>Download PDF in English

None