AU631371B2

AU631371B2 – A method for identifying and using biosynthetic or regulatory genes for enhanced production of secondary metabolites
– Google Patents

AU631371B2 – A method for identifying and using biosynthetic or regulatory genes for enhanced production of secondary metabolites
– Google Patents
A method for identifying and using biosynthetic or regulatory genes for enhanced production of secondary metabolites

Download PDF
Info

Publication number
AU631371B2

AU631371B2
AU39568/89A
AU3956889A
AU631371B2
AU 631371 B2
AU631371 B2
AU 631371B2
AU 39568/89 A
AU39568/89 A
AU 39568/89A
AU 3956889 A
AU3956889 A
AU 3956889A
AU 631371 B2
AU631371 B2
AU 631371B2
Authority
AU
Australia
Prior art keywords
host
gene
production
secondary metabolite
dna
Prior art date
1988-08-11
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)

Ceased

Application number
AU39568/89A
Other versions

AU3956889A
(en

AU631371C
(en

Inventor
Martinus Antonius Mathilda Groenen
Bertus Pieter Koekman
Pieter Van Solingen
Annemarie Eveline Veenstra
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)

DSM IP Assets BV

Original Assignee
Gist Brocades NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
1988-08-11
Filing date
1989-08-11
Publication date
1992-11-26

1989-08-11
Application filed by Gist Brocades NV
filed
Critical
Gist Brocades NV

1990-02-15
Publication of AU3956889A
publication
Critical
patent/AU3956889A/en

1992-11-26
Publication of AU631371B2
publication
Critical
patent/AU631371B2/en

1995-01-27
Application granted
granted
Critical

1995-01-27
Publication of AU631371C
publication
Critical
patent/AU631371C/en

1999-01-21
Assigned to DSM N.V.
reassignment
DSM N.V.
Alteration of Name(s) in Register under S187
Assignors: GIST-BROCADES N.V.

2004-04-08
Assigned to DSM IP ASSETS B.V.
reassignment
DSM IP ASSETS B.V.
Alteration of Name(s) in Register under S187
Assignors: DSM N.V.

2009-08-11
Anticipated expiration
legal-status
Critical

Status
Ceased
legal-status
Critical
Current

Links

Espacenet

Global Dossier

Discuss

Classifications

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09—Recombinant DNA-technology

C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA

C12N15/1034—Isolating an individual clone by screening libraries

C12N15/1072—Differential gene expression library synthesis, e.g. subtracted libraries, differential screening

C—CHEMISTRY; METALLURGY

C07—ORGANIC CHEMISTRY

C07K—PEPTIDES

C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi

C07K14/375—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from Basidiomycetes

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09—Recombinant DNA-technology

C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity

C12N15/52—Genes encoding for enzymes or proenzymes

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/09—Recombinant DNA-technology

C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts

C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes

C12N9/10—Transferases (2.)

C12N9/1025—Acyltransferases (2.3)

C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA

C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes

C12N9/88—Lyases (4.)

C—CHEMISTRY; METALLURGY

C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING

C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE

C12P37/00—Preparation of compounds having a 4-thia-1-azabicyclo [3.2.0] heptane ring system, e.g. penicillin

Description

Our Ref: 141530 ca t i r c I i d:
AUSTRALIA
Patents Act 3i3Y71 COMPLETE SPECIFICATION
(ORIGINAL)
Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: Applicant(s): Gist-brocades nv Wateringseweg 1, 2611 XT, Delft, THE NETHERLANDS Address for Service is: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Complete Specification for the invention entitled: A METHOD FOR IDENTIFYING AND USING BIOSYNTHETIC OR REGULATORY GENES FOR ‘ENHANCED PRODUCTION OF SECONDARY METABOLITES r Our Ref 11530 POF Code: 1219/1219 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): -1- 1 6006 M- A Gi Gist-Brocades N.V.
2486 S A METHOD FOR IDENTIFYING AND USING BIOSYNTHETIC OR REGULATORY GENES FOR ENHANCED PRODUCTION OF SECONDARY METABOLITES
INTRODUCTION
Technical Field «The subject field concerns the isolation and use of I genes for the production of secondary metabolitsez S0. Background and Relevant Literature 0 0 00 0 oo QQ 0 As a result of classical strain improvements, penicillin production has increased enormously over the last four decades. These classical strain improvements were primarily based on random mutagenic treatments of ote Penicillium chrysogenum and subsequent selection for mutants ,that produced more penicillin. The development of cloning techniques however has added a potentially powerful new tool 20 to further improve penicillin production in this fungus.
Penicillin is produced by the filamentous fungus P. chrysoqenum in several enzymatic steps E. Alvarez 3 et al., Antimicrob. Agents Chemother. 31 (1987) pp. 1675- 1682). These steps are shown in Figure 1. Throughout this specification is meant by genes directly involved in the biosynthetic pathway, those genes that encode the enzymes active in the several steps leading to the production of a secondary metabolite. So in case of the production of penicillin G or V, the genes encoding the enzymes in Figure 1 are meant. The first reaction is the formation of the tripeptide 6-(L-a-aminoadipyl)-L-cysteinyl-D-valine from a-amino adipic acid, cysteine and valine. The enzyme that is responsible for this reaction is the ACV synthetase (hereinafter referred to as ACVS), a large multifunctional enzyme. The tripeptide is cyclised by the action of the 2 isopenicillin N synthetase (hereinafter referred to as IPNS) or cyclase. The reaction product is is isopenicillin N, a compound that contains the typical P-lactam ring structure and that possesses antibacterial activity. The final step in the formation of penicillin is the exchange of the aaminoadipic acid side chain of isopenicillin N by a more hydrophobic side chain. The hydrophobic side chains commonly used in industrial production are either phenylacetic acid, yielding penicillin G and phenoxyacetic acid, yielding penicillin V. The side chain exchange has been proposed to be a reaction catalysed by a single enzyme Demain °(1983) in: A.L. Demain and N.A. Solomon Antibiotics ocontaining the p-lactam structure I. Springer Verlag, Berlin; pp. 189-228). However, a two step reaction involving 15 6-APA as an intermediate is also possible Alvarez et al., vide supra). The enzyme that has been identified to be involved in the final reaction is the acylCoA:6-APA acyltransferase (hereinafter referred to as AT); this enzyme has been purified to homogeneity Alvarez et al., vide supra). The involvement of a second enzyme, catalysing the reaction from IPN to 6-APA, cannot yet be confirmed nor S*o. excluded.
It is not clear either whether one or more enzymatic reactions are rate limiting in the process of penicillin 25 biosynthesis, and if so, which enzymatic steps are involved.
Since the penicillin biosynthetic route begins with three amino acids, which each in their turn are part of other metabolic routes, regulatory steps in these routes will also influence the biosynthesis of penicillin. On the other hand, the production of penicillin is subject to a complex mechanism of carbon catabolite repression and nitrogen source control Martin et al. In: H. Kleinkauf, H. von D6hren, H. Donnauer and G. Nesemann (eds), Regulation of secondary metabolite formation. VCH Verlaggesellschaft, Weinheim (1985), pp. 41-75). Regulatory proteins may also be involved in these types of regulation.
-3- These regulatory proteins, and the proto’ns regulated by them, are defined to be indirectly involved in the biosynthetic pathway of a secondary metabolite, in this case penicillin.
Until recently, the gene of only one of the enzymes active in the biosynthetic pathway to penicillin G, the isopenicillin N synthetase (IPNS) or cyclase, had been cloned and sequenced Carr et al., Gene 48 (1986) pp.
257-266), using the corresponding Acremonium chrysoqenum S 10 gene Samson et al. Nature 318 (1985) pp. 191-194). The I latter gene was cloned and identified by purifying the IPNS S’protein, determining the amino-terminal amino acid sequence, preparing a set of synthetic oligodeoxyribonucleotides So.”O: according to this sequence and probing a cosmid genomic :L5 library with these mixed oligodeoxyribonucleotides Samson, vide supra).
Strain improvement studies using the cloned Penicillium chrysoqenum isopenicillin N synthetase genes in t Penicillium chrysoqenum resulted in enhanced enzyme S 20 activity, but no improvement in penicillin production, nor stimulation of penicillin synthesis is found Skatrud et al., Poster presentation 1987 Annual meeting of Society of Industrial Microbiology, Baltimore, August 1987, abstract published in SIM News 37 (1987) pp. 77).
It has been documented that the biosynthesis of Plactam antibiotics is subject to glucose repression Martin and P. Liras, TIBS 1 (1985), pp. 39-44). This repression by glucose has been unequivocally established for the formation of the tripeptide by the ACVS and for the activity of the IPNS (Revilla et al., J. Bact. 168 (1986), pp. 947-952). For acyltransferase, on the other hand, the data are less convincing. Revilla et al (vide supra) report that AT is not subjected to glucose repression, but other data suggest that AT activity is absent, or at least decreased, in the presence of glucose Spencer and T. Maung, Proc. Biochem. Soc. 1970, pp. 29-30).
It is unknown at which stage of the expression the repression by glucose is exerted; this can be at the 1; .7 transcriptional or at the translational level. If the former regulation applies, differences in mRNA levels between producing and non-producing cultures could be employed to isolate the said genes.
There is further uncertainty on the levels of the mRNA’s encoding the various enzymes in penicillin producing cells.
SUMMARY OF THE INVENTION Subtraction isolation methods are employed for identifying genes associated with the production of secondary metabolites in microorganisms. The method is exemplified with production of penicillin in P. chrysogenum.
The present invention provides a method for enhancing the production of a secondary metabolite in a bacterium or fungus host which produces said secondary metabolite, said method comprising: screening a DNA library prcepared from a first host producing said secondary metabolite with probes obtained from mRNA or DNA derived therefrom from a second host of the same species lacking the production of said secondary metabolite; screening a genomic library of said first host with sequences which do not hybridize to said probes to identify fragments comprising genes transcribed in said first host L« 2’5 which are not transcribed in said second host; ‘preparing DNA constructs comprising said transcribed fragments and a marker for selection; transforming a candidate host capable of production of said secondary metabolite with said constructs and cloning the resulting transformants; and identifying clones producing said secondary metabolite at a higher level than said candidate host.
The present invention further provides a vector
S
l comprising a gene encoding a protein involved in production of a B-lactam antibiotic selected from the group consisting of an acyltransferase gene, cryptic gene Y and a cryptic gene present on any of clones L12, K9, C12, P3, Kll, ,B13, B20, G3, Gl, L10, K16, and B23, a marker for 4 3a
L..
I
selection in a host producing said B-lactam antibiotic and optionally a sequence for enhancing transformation efficiency of said vector in said host.
The present invention further provides a transformed host capable of increased expression of a B-lactam antibiotic selected from the group consisting of Penicillium, Aspergillus, Acremonium, and Actinomycetes, comprising as a result of transformation an extra copy of a sequence comprising a gene selected from the group consisting of an acyltransferase gene, cryptic gene Y, and a cryptic gene I present on any of clones L12, K9, C12, Kll, B13, B20, G3, Gl, L10, K16 and B23, and encoding a protein involved in production of a B-lactam antibiotic.
The present invention further provides a method for providing improved yields of a B-lactam antibiotic comprising: growing a transformed host comprising an extra copy of a sequence comprising a gene selected from the group consisting of an acyltransferase gene, cryptic gene Y, and a cryptic gene present on any of clones L12, K9, C12, P3, Kll, B13, B20, G3, GI, L10, K16, and B23, encoding a protein involved in production of said -lactam antibiotic resulting in enhanced production of said B-lactam antibiotic.
The present invention further provides a gene encoding a protein involved in production of a secondary 3 25 metabolite, said gene prepared according to a method comprising screening a DNA library prepared from a first tr €t i host producing said secondary metabolite with probes obtained from mRNA or DNA derived therefrom from a second host of the Ssame species lacking the production of said secondary metabolite; and screening a genomic library of said first host with sequences which do not hybridize to said probes to identify fragments comprising genes transcribed in said first host which are not transcribed in said second host.
The present invention further provides a DNA construct comprising a gene encoding a protein involved in the production of a secondary metabolite and a marker for selection in a host producing said secondary metabolite, said gene prepared according to a method comprising screening a S- 3b
~TPLSF~~
DNA library prepared from a first host producing said secondary metabolite with probes obtained from mRNA or DNA therefrom from a second host of the same species lacking production of said secondary metabolite; and (2N screening a genomic library of said first host with sequences which do not hybridize to said probes to identify fragments comprising genes transcribed in said first host which are not transcribed in said second host.
o t t 4 44,4 t t t t 4 t 4 4 t 3c -4regulation applies, differences in mRFNA level/between producing and non-producing cultures coul /e employed to isolate the said genes.
There is further uncertaint on the levels of the mRNA’s encoding the various enz es in penicillin producing cells.
SUMA Y OF THE INVENTION Subtractio /isolation methods are employed for identifying g es associated with the production of Ssecondary etabolites in microorganisms. The method is S-icilLin in P. rh rym gjnu.-Ae 0 00 0 15 BRIEF DESCRIPTION OF THE DRAWINGS.
Figure 1 The biosynthetic pathway to penicillin G or V in P. chrysoqenum is shown schematically.
Figure 2 Physical map of lambda clones isolated by the method of the invention. Clones lambda G2 and lambda B21 contain the cyclase and acyltransferase gene cluster. Clones lambda B9, GS and L5 contain the cryptic gene Y. Other lambda 25 clones contain other cryptic genes.
E EcoRI; B BamHI; H HindIII; K KpnI; S Sall; Sa SacI; Sp SphI; P PstI; X XhoI; Xb XbaI; Hp HpaI; N NcoI and Bg BglI MSSI right arm of bacteriophage lambda EMBL3 (9 kb) -1 left arm of bacteriophage lambda EMBL3 (20.3 kb) region that hybridizes to pen cDNA unclear region of map S) position/occurrence of restriction site not clear la and ra are left arm and right arm respectively of bacteriophage lambda.
Figure 3 Nucleotide sequence and deduced amino acid sequence of the P. chrysocenum acyltransferase gene.
Figure 4 d 9 i 44 44 44r 4 4 Nucleotide sequence and deduced amino acid sequence of the P. chrysoqenum pyrG gene. This sequence forms the major part of the 2.4 kb EcoRI fragment that acts as a transformation stimulating sequence.
Figure Nucleotide sequence of the promoter of the P.
chrysoqenum phosphoglycerate kinase gene.
Figure 6 A restriction site and functional map of pUC13::pyrG. A 4 kb Sau3A partial DNA fragment containing the P. chrysoqenum pyrG gene was cloned into the BamHl site of plasmid pUC13 to give pUC13::pyrG.
4 Figure 7 A restriction site and functional map of pPS54.
pPS54 was constructed by inserting a 2.4 kb EcoRI DNA fragment containing the P. chrysoqenum pyrG gene into pPS47.
Figure 8 A restriction site and functional map of pRH05 was constructed by subcloning the gene as a 3.0 kb BamHI/SphI fragment into pPS47.
Figure 9 A restriction site and functional map of pRH05. A kb SalI fragment containing the IPNS plus AT cluster was treated with T4 DNA polymerase and ligated into the unique HindIII site of pPS54 after treatment of this vector with T4 DNA polymerase. pGJOlA and pGJ01B contain the fragment in opposite orientations.
5 i: i i ~~i Fiqure A restriction site and functional map of pPS47.
pPS47 was constructed by cloning the P. chrysoqenum pgk promoter as a 1.5 kb HindIII fragment into pTZ18R. The phleomycin resistance gene was isolated from pUT702 as a kb BamHI/BqlII fragment and subsequently cloned into the BamHI site of the polylinker. The pgk promoter was fused in frame to the phleomycin resistance gene to give pPS47.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS In accordance with the subject invention, DNA fragments are identified which include sequences which are mono- or polycistronic. The gene(s) encoded by the sequences are translated to enzymes concerned with the production of secondary metabolites or other products of commercial 06 Sa 0t o 0 0 -7 5a 6 interest. These sequences of interest are identified by comparison of RNA sequences isolated from an organism competent to produce the secondary metabolite, where the genes of interest are actively expressed, and a microorganism in which expression is silent. In this way DNA fragments are provided encoding one or more genes that are differentially expressed and that are involved in the formation of a product of commercial interest.
Differentially expressed is used throughout this application 10 for expression of the gene(s) of interest that is rt specifically active only under certain defined conditions and that is absent (which is meant in this specification to t be present at a low level e.g. a level of 5% or less, as compared to the active stage) under other, equally well defined conditions. The absence of expression may be a res&lt of repression or lack of induction of gene ex’,.assion, mutation, or uther events which result in transcriptional silence of the gene(s) of interest. The DNA which is isolated may result from screening a gene library, either genomic or cDNA library contained in e.g. a lambda or a cosmid cloning vector or in an expression vector. By t, employing a cDNA probe enriched for sequences expressed during the biosynthesis of secondary metabolites, positive hybrids may be identified in the library for subsequent 25 manipulation to provide for expression constructs for the enzyme(s) associated with the production of the secondary metabolite. Therefore a gene library of a microorganism is screened using two cDNA probes, one of which is enriched for sequences from the transcriptionally ,7tive state and the other is derived from the transcriptionally silent situation. By comparison and subtraction those clones that contain gene(s) that are actively expressed under the defined active conditions only, can be isolated.
The method is exemplified by the isolation of genes involved in the biosynthesis of a secondary metabolite, more specifically penicillin, using two cDNA probes, from lactose grown (producing) and glucose grown (non-producing) mycelium.
The identified DNA seqvpences will comprise at least one gene encoding an antibiotic biosynthetic enzyme and/or a regulatory protein from the entire biosynthetic pathway, or more generally any protein that is involved in whatever way, either positive or negative, in the biosynthesis of said antibiotic.
The positively acting constructs, when properly introduced into a suitable host microorganism increase the efficiency of the biosynthetic pathways operative in Pj 10 lactam producing microorganisms by increased gene dosage, or by higher gene expression. On the other hand, constructs may be isolated that have a negative effect on the antibiotic production formation of side products). These Sconstructs are employed to inactivate the negatively acting j *o 15 gene by gene replacement or other methods with a similar effect. Both uses result in higher yields of the desired antibiotic during industrial production. This method is exemplified by and finds particular application with 6tlactam producing microorganisms for the production of antibiotics, particularly penicillins. Preferably, the ocatalyze rate-limiting steps or genes encoding regulatory proteins for induction of transcription or otherwise.
The subject method further provides squences for 25 which the encoded product is not known, but ,B sequence is found to provide an enhanced yield of a desired product.
These sequences are referred to as “cryptic genes”, which means sequences obtainable by isolation methods described ‘i herein, which sequences encompass genes for which no known function is yet assignable. These genes are characterized by being dosed and/or expressed in higher amounts in the transformed host-microorganisms as compared with their untransformed hosts. In addition to the “cryptic genes”, other genes provided are ;PNS and acyltransferase. A cryptic gene named was shown to provide enhanced biosynthesis of penicillin.
The microorganisms employed in the subject invention include both prokaryotes and eukaryotes, including bacteria preparing DNA constructs comprising said transcriDed fragments and a marker for selection; transforming a candidate host capable of production of said secondary metabolite with said constructs and cloning the resulting transformants; and /2 -8such as those belonging to the taxonomic group of the Actinomycetes or Flavobacterium, or fungi including yeasts, belonging to the genera Aspergillus, Acremonium or Penicillium.
Depending upon the source of the fragment, either genomic or cDNA, either prokaryotic or eukaryotic, various expression cassettes may be constructed. With genomic DNA from a bacterium, the fragment containing a mono- or polycistronic coding region may include its own transcriptional initiation regulatory region, as well as a transcriptional termination region and appropriate 1 translational signals, e.g. Shine-Delgarno sequence and stop codons. Where the genomic DNA is from a fungus, normally Sonly one gene will be associated with a transcriptional 15 initiation regulatory region, so that each gene will have it. own independent transcriptional initiation regulatory j region. Where cDNA is employed, it vlil be necessary to provide an appropriate transcriptional initiation regulatory “region, depending on the host organism used for subsequent expression.
The genes of interest may be obtained by screening a DNA library prepared from said microorganism with probes obtained from mRNA or DNA derived from a first culture of said microorganism, producing said secondary metabolite; 1 ,i 25 screening said DNA library with probes obtained from mRNA or S.44t DNA derived from a second culture of said microorganism or a mutant thereof, lacking the production of said secondary metabolite; and identifying fragments comprising genes transcribed in said first culture which are not f 30 substantially transcribed in said second culture.
Particularly valuable genes include those which are specifically expressed during antibiotic biosynthesis, including the genes encoding 9-lactam biosynthetic enzymes known in the art, e.g. tripeptide synthetase (ACVS), cyclase (IPNS), acyltransferase epimerase, expandase, hydroxylase, transcarbamoylace, iiethoxylase, transacetylase.
Preferably genes encoding IPN:6-APA acyltransferase or the cryptic gene are dosed or expressed in higher amounts -i, jLI=Ic. LJu.ij; cnIu z) screening a genomic library of said first host with sequences which do not hybridize to said probes to identify fragments comprising genes transcribed in said first host which are not transcribed in said second host.
9 resulting in higher yields of the desired antibiotic in the transformed fungus.
It will be appreciated by those skilled in the art, that the gene(s) to be expressed in a p-lactam producing host may either carry its own native promoter sequence which is recognized by an RNA polymerase of the host cell, or may be ligated to any other suitable promoter, e.g. that of a different i-lactam biosynthetic gene or that of a glycolytic gene such as phosphoglycerate kinase, glyceraldehyde phosphate dehydrogenase, triose phosphate isomerase, or that of the translational elongation factor, Ef-Tu, or the like.
Such a promoter may be employed to influence regulation of expression of one or more genes encoding said enzymes. This will lead to an increased production of the 9 15 antibiotic after transformation, since penicillin production S”°0 is now also possible under conditions that in the untransformed host strain do not lead to penicillin prc-uction, e.g. glycolytic enzymes are expressed in the presence of glucose, while the production of penicillin, on the other hand, is repressed in the presence of glucose Martin, vide supra). By bringing the expression of .o t. penicillin biosynthetic genes under the control of a promoter of a glycolytic gene, the genes can also be expressed in the presence of glucose and hence penicillin can be produced early in the fermentation, when a high concentration of glucose is required for the generation of a sufficient amount of mycelium. Also the selection marker can be brought under control of such a promoter.
The present invention exemplifies the promoter of the phosphoglyceratekinase gene of P. chrysoqenum as a promoter to be used to overcome glucose repression of penicillin biosynthesis. This promoter was isolated from a genomic library of P. chrysogenum by standard methods, using oligodeoxyribonucleotide probes derived from the published yeast sequence of R.A. Hitzeman et al., Nucleic Acids Res. UK (1982) pp. 7791-7808. The nucleotide sequence of the phosphoglyceratekinase promoter is specified in Figure S| w 6006 10 For transformation of Penicillium, constructs are employed including at least one marker for selection of transformed cells and, preferably, for enhancing maintenance of the integrated DNA. Therefore, the vector preferably includes a DNA sequence known to enhance transformation effic *encies. An example of such a DNA sequence is the “ans”-element, isolated from AsrerQillus nidulans (cf.
Ballance and Turner, Gene 36 (1985) pp. 321-331). The present invention providc- a DNA sequence, isolated from the genome of P. chrysoqenum, that has been identified as a sequence with an effect similar to the effect of the “ans” sequence. Since this sequence is native to P. chryspienum, it can be used to increase transformation efficiencies in P.
oo chrysogenum. The DNA sequence encompasses the P. chrysoqenum o o 15 pvrG gene and can be used either alone, in combination with *a pvrG-host, in which case said DNA sequence provides both o 0 the selection for transformants and the transformation 0 04 enhancing effect (cf. EP-A-260762), or in combination with another selection marker, e.g. a gene encoding resistance to a biocide, such as phleomycin. In the latter case selection ,4 for transformants and the transformation enhancing effect are provided by two separate DNA sequences and the sole function of the pyrG element is to enhance transformation frequencies.
Useful markers for the selection of transformant clones may be homologous or heterolc ous biosynthetic genes capable of complementing an auxotrophic requirement of the host cell, caused by a defect in a metabolic route to an amino acid, e.g. arginine, a nucleotide precursor, e.g.
i 30 uracil, and the like.
The structural gene providing the marker for selection may be native to the wild-type Penicillium host or a heterologous structural gene which is functional in the host. For example, structural genes coding for an enzyme in a metabolic pathway may be derived from Penicillium or from other filameintcw fungi, e.g. Asperqillus, Neurospora, PoE spora, or 7easts, where the structural gene is -i ia-amino adipic acid, cysteine and valine. The enzyme that is responsible for this reaction is the ACV synthetase (hereinafter referred to as ACVS), a large multifunctional enzyme. The tripeptide is cyclised by the action of the if ~wm~ 11- 1 o 0* 0 00 o 00 o a 00 0 0*0 0 000 0 *0 0 0~ *0 0 0 0 functional in the Penicillium host and complements the auxotrophy to prototrophy.
The complementing structural gene may be derived from a metabolic pathway, such as the synthesis of purines or pyrimidines (nucleosides) or amino acids. Of particular interest are structural genes encoding enzymes in the pyrimidine pathway, e.g. the gene encoding the enzyme orotidinedecarboxylase (pyrG or pyr4). Other genes of interest are amino acid biosynthetic genes, e.g. ornithine carbamoyl transferase (arcB) and arginino-succinate lyase (arc4). The use of the above-mentioned selection markers is provided in EP-A-260762.
Instead of auxotrophic markers, fermentation markers may be used, such as the capability of using amides 15 as a sole source of carbon or nitrogen, growth on various sugars, e.g. galactose or the like.
Furthermore, genes encoding resistance to biocides may be used, such as hygromycin, gentamicin, phleomycin, glyphosate, bialaphos, and the like.
Constructs will be provided comprising the sequence of interest, and may include other functions, such as replication systems in one or more hosts, e.g. cloning hosts and/or the target host for expression of the secondary metabolite; one or more markers for selection in one or more hosts, as indicated above; genes which enhance transformation efficiency; or other specialized function.
The construct will contain at least one gene isolated by the method of this invention. The construct may be prepared in conventional ways, by isolating other desired genes from an appropriate host, by synthesizing all or a portion of the genes, or combinations thereof. Similarly, the regulatory signals, the transcriptional and translational initiation and termination regions, may be isolated from a natural source, be synthesized, or combinations thereof. The various fragments may be subjected to endonuclease digestion (restriction), ligation, sequencing, in vitro mutagenesis, primer repair, or the like. The *000 0 00 8 *0 O 0 C *0 0 00 00 @0 *00000 0 *00*00 0 0 Verlaggesellschaft, Weinheim (1985), pp. 41-75). Regulatory proteins may also be involved in these types of regulation.
*1 1 12 various manipulations are well known in the literature and will be employed to achieve specific purposes.
The various fragments may be combined, cloned, isolated and sequenced in accordance with conventional ways.
After each manipulation, the DNA fragment or combination of fragments may be inserted into the cloning vector, the vector transformed into a cloning host, e.g. E. coli, the cloning host grown up, lysed, the plasmid isolated and the fragment analyzed by restriction analysis, sequencing, combinations thereof, or the like. E. coli may also be used as a host for expression of the genes of interest, with the aim to produce high amounts of protein.
Various vectors may be employed during the course of development of the construct and transformation of the o 15 host cell. These vectors may include cloning vectors, 1 3 o expression vectors, and vectors providing for integration into the host or the use of bare DNA for transformation and integration.
The cloning vector will be characterized, for the most part, by a marker for selection of a host containing the cloning vector and optionally a transformation stimulating sequence, may have one or more polylinkers, or o 9D additional sequences for insertion, selection, manipulation, ease of sequencing, excision, or the like.
25 Expression vectors will usually provide for insertion of a construct which includes the transcriptional and translational initiation region and termination regions; alternatively the construct may lack one or both of the r regulatory regions, which will be provided by the expression vector upon insertion of the sequence encoding the protein product.
The DNA encoding enzyme(s) of interest may be introduced into a Penicillium host in substantial accordance with the procedure as described in EP-A-260762.
Efficient transformation of Penicillium is provided to produce transformants having one or more structural genes capable of expression, particularly integrated into the host genome (integrants). DNA constructs
J
i 13 are prepared which allow selection of transformed host cells. Conditions are employed for transformation which result in a high frequency of transformation, so as to ensure selection and isolation of transformed hosts expressing the structural gene(s) of interest. The resulting transformants provide for stable maintenance and expression of the integrated DNA. It will be appreciated that the transformed host according to the invention can be used as starting strain in strain improvement processes other than DNA mediated transformation, for instance, protoplast fusion, mass mating and mutation. The resulting strains are considered to form part of the invention.
o* The genes of interest to be introduced by transformation may form an integral part of the o 0o0 15 transformation vector, but it will often be more convenient to oifer these genes on a separate vector in the transformation mixture, thus introducing the said genes by cotransformation along with the selective vector, which is a fairly efficient process in filamentous fungi Punt et al., Gene 56 (1987) pp. 117-124; K. Wernars et al, Mol. Gen.
Genet. 209 (1987) pp. 71-77; I.E. Mattern et al., Mol. Gen.
Genet. 210 (1987) pp. 460-461).
S .o As a result of the transformation, there will be at least one copy of the gene(s) of interest frequently two or 25 more, usually not exceeding about 100, more usually not exceeding about 10. The number will depend upon whether integration or stable episomal maintenance is employed, the number of copies integrated, whether the subject constructs are subjected to amplification and the like.
The subject invention exemplifies a method to isolate genes involved in penicillin biosynthesis from a gene library of the producing organism, P. chrysogenum, using specific cDNA probes which method is paradigmatic for identifying cryptic genes for the enhanced production of secondary metabolites. This method for the isolation of DNA constructs encoding one or more genes that take part in the biosynthesis of secondary metabolites, comprises the screening of a gene library with a cDNA probe enriched for SL; prising a gene encoding a protein involved in production of a B-lactam antibiotic selected from the group consisting of an acyltransferase gene, cryptic gene Y and a cryptic gene present on any of clones L12, K9, C12, P3, Kll, -Bl3, B20, G3, Gl, L10, K16, and B23, a marker for 3a 14 14 sequences specifically expressed during the biosynthesis. By “specifically” expressed is meant that expression of these genes is silent or at a very low level (for example less than 5% of production level) in the absence of penicillin production and in contrast is high during penicillin production. To this end, radioactive or other labeled cDNA probes are synthesized on mRNA templates isolated from P. chrysoenum mycelia during the penicillin production phase.
The probes are then enriched for sequences hybridizing specifically to the desired genes by eliminating those cDNA sequences that hybridize to mRNA derived from a Penicillium fermentation under conditions not allowing penicillin production, e.g. high glucose concentration.
15 Using this enriched probe, clones are selected from a P.
s c chrysoqenum gene library that do not hybridize to a probe Sderived from non-producing mycelia. A large number of the clones thus isolated appears to encode the penicillin biosynthetic enzyme isopenicillin N synthetase (IPNS or cyclase).
Furthermore, among the selected clones, several I copies of the gone encoding the side-chain exchanging enzyme S(acyltransferase) are found to be present. This was proven with experiments where a DNA probe was employed, based on the aminoterminal peptide sequence of the purified enzyme.
The identity of these clones is biochemically and biologically verified. The nucleotide and deduced amino acid sequence of the acyltransferase gene are specified in Figure 3. Surprisingly, the genes encoding the isopenicillin N synthetase and acyltransferase enzymes are present together on one DNA fragment. This was demonstrated by hybridization of a genomic library of P. chrysoenum in the lambda vector EMBL 3 with separate probes, specific for each of both said genes. Identical clones hybridize separately with both probes.
Moreover, after construction of a physical map of one genomic lambda clone, and hybridization of restriction digests of the lambda clone with separate probes for both a4, oiso heg.n noig h iecanewhnigezm ne preSent invention further provides a DNA construct comprising a gene encoding a protein involved in the production of a secondary metabolite and a marker for selection in a host producing said secondary metabolite, said gene prepared according to a method comprising screening a 3b S* 15 of the genes, the genomic organization was shown to be such as depicted in Figure 2 (clones B21 and G2). The presence of both genes on one large DNA fragment allows construction of P. chrysogenum strains with a higher dosage of both the isopenicillin N synthetase and acyltransferase genes, without disturbing the relative organization or the balanced expression of both genes. Moreover, the introduction of multiple copies of said large DNA fragment allows expression of both genes on said DNA fragment in their natural environment with upstream and downstream sequences that are identical to the normal situation.
Both the balanced expression and the maintenance I 9 Sof the natural environment prove to be Deneficial for the oleo efficiency of gene expression and hence of penicillin production. The isolation techniques of the isopenicillin No synthetase plus acyltransferase gene cluster may be 1 advantageously applied for the isolation of other penicillin Sbiosynthetic genes by chromosome walking techniques, where the penicillin biosynthetic genes may be clustered.
Furthermore, a number of cryptic genes have been 4 t° isolated, to which no function has been assigned yet but j which are likely to play a part in p-lactam biosynthesis. A physical map of the cryptic genes of the invention is provided in Figure 2 (clones B9-B23).
Of these “cryptic” genes, the gene designated Y, present on clones B9, L5 and G5, when transformed (on a kb SphI BamHI subfragment) to a suitable host, stimulates the production of penicillin by 26%, compared to the untransformed host. This demonstrates the involvement of the product of gene Y in penicillin biosynthesis. Moreover, this demonstrates that transformation using genes isolated by the method of the invention, without knowing their function or identity, can be applied successfully in strain improvement of P. chrysoqenum.
The present invention is further exemplified by transforming Penicillium chrysoqenum with genes that are specifically expressed under conditions where the antibiotic S- 3c 16 is synthesized, and which encode gene products catalyzing biosynthetic reactions leading to the said antibiotics.
One such enzyme, acyltransferase (hereinafter referred to as AT), catalyzes the final step in penicillin biosynthesis, i.e. the exchange of the aminoadipyl moiety of isopenicillin N with a hydrophobic acyl side chain precursor, e.g. phenylacetic or phenoxyacetic acid, thus yielding penicillin G or V, respectively.
The acyltransferase gene of P. chrysoqenum is provided, including the nucleic acid sequence. The invention provides conservative mutations, where the sequence encodes the same amino acid sequence, but may have oo as many as 30% different bases, more usually not more than about 10% different bases, or mutations which are non- S 15 conservative, where fewer than about 10%, more usually fewer 1 than about and preferably not more than about 1% of the amino acids are substituted or deleted, and there are fewer Sthan 5% of inserted amino acids, where the percent is based on the number of naturally occurring amino acids. In addition, fragments of both the nucleic acid encoding the a «enzyme, usually at least about 9 codons, more usually at least about 15 codons may be employed, as well as their expression products, as probes, for the production of S, antibodies, or the like. The probes may be used to identify the enzyme in other species by employing the nucleic acids for hybridization or the antibodies for identification of cross-reactive proteins.
The search for unnatural side chain precursors or other penicillins or cephalosporins that will serve as a substrate for the acyltransferase can be complemented by a search for mutant acyltransferase enzymes that will accept as a substrate side chain precursors other than phenylacetic acid or phenoxyacetic acid, or penicillins or cephalosporins other than the natural substrate isopenicillin N. The present invention provides the starting material for such a search for a mutant acyltransferase enzyme. coli is the best host for mutational cloning experiments; since E. coli lacks the splicing machinery for the removal of the introns clear la and ra are left arm and right arm respectively of bacteriophage lambda.
17 present in this acyltransferase.gene, a cDNA clone of the acyltransferase gene is the sequence of choice for expression of the enzyme in E. coli. This cDNA sequence can be readily mutated by procedures well known in the art, such as, for example, treatment with radiation (X-ray or UV) or chemical mutagens (such as ethylmethanesulfonate, nitrosoguanidine or methylmethanesulfonate) or site specific mutagenesis, to obtain mutant enzymes that on the one hand recognize unnatural side chain precursors as a substrate and catalyze the formation of unnatural penicillins from isopenicillin N, or on the other hand catalyze a side chain exchange reaction on penicillins or cephalosporins, other than isopenicillin N.
SThe isolation of the AT-, Y- and other penicillin t 15 biosynthetic genes allows for the identification of regulatory elements of the individual genes such as a promoter, an upstream activating sequence (UAS), a terminator and the like. This can be achieved by sequence comparison of the genes amongst themselves and by comparison with the sequence as obtained for the isopenicillin N synthetase biosynthetic gene and other related genes. This latter comparison, moreover, may disclose the specific nature of the regulation of the gene expression of the group of penicillin biosynthetic genes.
Identification of such a “penicillin biosynthetic regulatory element” leads to identification of specific ,I regulatory proteins by means of standard techniques as gel retardation, cross-linking, DNA footprinting and the like.
Isolation of the specific regulatory protein by affinity chromatography will result in the cloning of the gene encoding said protein and subsequent manipulation in a suitable host.
By use of the cloned AT-gene, Y-gene and other penicillin biosynthetic genes, modified enzymes may be designed and synthesized. These modifications will result in modified characteristics of the enzymes, such as a change in pH or temperature optimum, a change in stability or a change in substrate specificity. Host strains, transformed with -18 genes encoding these modified enzymes, may be programmed to perform antibiotic synthesis under different conditions or to synthesize alternative antibiotics, e.g. ampicillin instead of penicillin.
In another aspect of the invention, the cloned genes may be used to transform host strains that do not naturally posses-i these enzymes. It is known that Streptomvces an. Acremonium do not possess the AT-enzyme, while on the other hand Penicillium lacks the genes from the cephalosporin and cephamycin biosynthetic enzymes.
Introduction of such genes into the hosts will result in biosynthesis of cephalosporin or cephamycin by Penicillium 0° or penicillin or cephalosporins with a hydrophobic side chain by Acremonium.
It is evident from the following results that
S
1 ~secondary metabolite production can be greatly enhanced by employing screening procedures which allow for identification of DNA sequences associated with production of a secondary metabolite. By using subtraction methods in identifying specific sequences associated with secondary metabolite production, mRNA and cDNA may be isolated and identified for use as probes. Thus, fragments containing Scryptic genes, which will not yet have a known function are 4 found to greatly enhance secondary metabolite production and may be transformed into a host for production of the secondary metabolite. This procedure is specifically Sexemplified for penicillin.
In addition, an acyltransferase gene is provided which finds use in a variety of ways, as an enzyme for modifying P-lactam compounds, as a label, as a source of an antigen for a production of antibodies to acyltransferase, as a source for a promoter sequence, as a source to express high amounts of protein for crystallization as a template for in vitro mutagenesis to obtain an enzyme with modified characteristics, and the like.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were 5a ’19 3 3 19 specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described I in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and j modifications may be made thereto without departing from the spirit or scope of the appended claims.
The following examples are offered by way of illustration and not by way of limitation.
oj.o EXPERIMENTAL EXAMPLE 1 o 0° 0. 15 Construction of a genomic library 0 44 0 0 of Penicillium chrysoqenum.
00 0 0 A genamic library of Penicillium chrysoqenum (ATCC 28089) was constructed in substantial accordance with methods known in the art Maniatis et al., (1982), Molecular cloning, A Laboratory Manual, Cold Spring Harbor 1 Laboratory, Chromosomal DNA was extracted from 0: Penicillium chrvsogenum by forming protoplasts from the mycelium as previously described in EP-A-260762.
S, 25 The protoplasts were then lysed by diluting the isotonic (0.7 M KC1) suspension with four volumes of TES buffer (0.05 M Tris-HCl pH 8.0, 0.1 M EDTA, 0.15 M NaCl). To S the lysate, 1% sodium lauryl sulphate was added and the S mixture was incubated at 55°C for 30 min. After one extraction with phenol and two extractions with chloroform, I the DNA was precipitated with ethanol, dried, and diSsolved in TE buffer (10mM Tris, ImM EDTA pH The DNA solution was then treated with 100 Ag/ml RNase at 37 0 °C for 1 h and subsequently with 200 gg/ml proteinase K at 42°C for 1 h.
The solution was extracted once with phenol and twice with chloroform. An equal volume of isopropanol was layered on top of the aqueous phase and the DNA was collected at the interface by spooling around a glass rod. After drying, the The method is exemplified by the isolation of genes involved in the biosynthesis of a secondary metabolite, more specifically penicillin, using two cDNA probes, from lactose grown (producing) and glucose grown (non-producing) mycelium.
-4 20 DNA was dissolved in TE buffer. The molecular weight of the DNA preparation thus obtained was about 108. The DNA was partially digested with Sau3A, ligated to dephosphorylated EMBL 3 arms cut with BamHI (Promega Biotec, Madison WI, USA), and packaged into bacteriophage lambda capsids using the Packagene System of Promega Biotec. All reactions were carried out in accordance with the manufacturer’s recommendations except that the packaging reaction was carried out at 22″C for 2-3 hours. Libraries were amplified by plating the packaged phages, incubating for 7-8 hours at 37″C and eluting the phages using 4 ml of SM buffer (0.1 M NaCl, 0.01 M MgSO 4 0.05 M Tris HC1 pH 7.5, 0.01% gelatin) per Petri plate.
09 0 Genes that are specifically or predominantly Sexpressed during penicillin biosynthesis were identified by 2 0 i probing the genomic library of Example 1 with labelled cDNA probes synthesized on mRNA templates extracted from producing (lactose-grown) and non-producing (glucose-grown) mycelia, and selecting the clones that gave predominantly a Spositive signal with the former probe.
Messenger RNAs were isolated from cultures grown 3 or 6 days in the production medium (cf. Example 3) preparation) or in the same medium with the lactose replaced by glucose (-preparation). The mycelia were collected by filtration, frozen in liquid nitrogen, homogenized and the mRNA isolated using the guanidinium isothiocyanate method as described by T. Maniatis et al. (vide supra).
cDNAS were synthesized and labelled to a high specific activity with [a, 32 P] dATP against both mRNA populations in a reaction mixture of 30 Al containing other genes provided are “PNS and acyltransferase.
A
cryptic gene named was shown to provide enhanced biosynthesis of penicillin.
The microorganisms employed in the subject invention include both prokaryotes and eukaryotes, including bacteria ~C I’ r’l T IB r r I
A-
i ~S411*C–II-i”l-Y 21 12.5 50 100 125 2 500 500 500 0.1 100-200 50-60 q mM mM mM mM u/Ml sM
MM
AM
MM
ig/ml Mg/ml Mg/ml u/l pCi/il MgC12 Tris-HCl pH 8.3 KC1
DTT
RNasin dGTP dCTP dTTP dATP
BSA
pcy A+RNA oligo dT 12 18 reverse transcriptase [a- 3 2 p] dATP O 06 0 04 to 0VV 0 4040
II
o 00 460 01 o .4 04 0 0) 6 0q 0 6046 00 bo C O 04 0999
I.
1.67 in which the PolyA+ RNA and oligo-dT were mixed separately, heated to 100*C for 1 minute, and cooled in ice water prior to adding to the reaction mixture. After 1.5 hours incubation at 42*C, 5 Ml of 1 mM dATP was added and the 20 incubation continued for 30 min. Subsequently, the reaction mixture was made 20 mM in EDTA, 40 mM in NaOH (final volume 100 gl) and heated to 65’C. After 1 hour incubation, 5 Al 1 M Tris-HC1 pH 8.3, 40 pl 0.1N HC1, 7 Mg calf thymus DNA, 100 Ml TES buffer (10 mM Tris, 1 mM EDTA, 1% SDS pH 7.5) and 200 Al 5 M ammonium acetate were added and the DNA was precipitated with 800 Ml ethanol for 16 hours at The precipitate was collected by centrifugation, washed with 70% ethanol, dried, and dissolved in 32.5 pi of TE buffer (10 mM Tris, 1 mM EDTA pH The cDNA preparation was then enriched for sequences specifically expressed during penicillin biosynthesis by two successive rounds (cascades) of hybridization against a mRNA preparation in a reaction mixture of 75 Al containing (IPNS), acyltransferase epimerase, expandase, hydroxylase, transcarbamoylase, methoxylase, transacetylase.
Preferably genes encoding IPN:6-APA acyltransferase or the cryptic gene are dosed or expressed in higher amounts ij; 22 32.5 pl cDNA Ml mRNA (1 Ag/Ml) 1l IM NaPO 4 pH 6.8 Ai 10% SDS 1 ll 0.5 M EDTA After incubation for 16 hours at 68 C, 102 Al of water was added (final phosphate concentration 170 mM) and the mixture passed through an hydroxylapatite column equilibrated in 170 mM phosphate at 68°C. Under these conditions, double stranded nucleic acids bind to the column whereas single stranded nLuleic acids are eluted. The eluate was collected, dialyzed against TE buffer for 1.5 hours, and S ethanol precipitated after addition of 4 pg carrier (calf S. 15 thymus) DNA. This procedure was repeated and the final S’ unbound cDNA was directly used as a probe to screen a S* genom.c library of the Penicillium strain as follows: A sample of the amplified library of Example 1 was plated onto 5 Petri plates so as to contain approximately 1500 plaques per plate. The plaques were transferred in duplicate to Gene Screen Plus filters (New England Nuclear) S according to the manufacturer’s recommendations. One set of Stofilters was probed with the labelled, enriched (+)cDNA preparation; the duplicate set was probed with the labelled 25 (-)cDNA as a control.
Positive plaques were purified and subjected to a second screening. In this way, 96 plaques were selected that gave a positive signal predominantly with the (+)cDNA probe.
DNAs of recombinant phages that had given a strong or moderate signal in the initial screening were labelled with 3 2 P and used as probes to screen Northern blots of Penicillium RNAs isolated from producing and non-producing mycelia, in order to establish the levels of expression under both conditions. In this way the recombinant clones were divided into three groups: Class 1 contains genes highly expressed during penicillin biosynthesis and is exemplified by clones 23 G2 and B21 B9, L5 and L12 K9 I* Class 2 moderately expressed, exemplified by C12 P3 and K11 B13 Class 3 weakly expressed, exemplified by S* G3 1o S* G1 K16 15 L10 B23 o0 o Physical maps of these recombinant phages are shown in Figure 2. Clones G2 and B21 gave a positive hybridization signal when probed with an isopenicillin N synthetase-specific probe Samson et al., vide supra).
Surprisingly, the same clones appeared also to hybridize to °00 an acyltransferase-specific probe (see Example V o 99 9 Ct c a merabolic pathway may be derived from Penicillium or from other filaiaentow- fungi, e.g. Asercillus, Neurosqpora, XoSoA, or yeasts, where the structural gene is 23 *G2 an'” B21 *B9, L5 and *L12 *K9 class 2 moderately expressed, exemplified by *C12 *P3 and K11 *B13 class 3 weakly expressed, exem~plified by *G3 Gi K16 L1O* B23 physical maps Of these recombinant phages are £shown in Figure 2. Clones G2 and B21 gave a positive hybridization signal when probed with an isopenicillin N synthetase-specific probe Samson et al., vd ur) Surprisingly, the same clones appeared also to hybridize to an acyltransferase-specific probe (e xml *0 e -LV QtIsliv- my De sunjected to endonuclease digestion (restriction), ligation, sequencing, in vitro mutagenesis, primer repair, or the like. The 24 24 EXAMPLE 3 Purification of acyltransferase.
Penicillium chrysogenum strain (ATCC 28089) was inoculated (at 2 x 106 conidia/ml) in a complex seed medium containing: corn steep liquor (20 distiller solubles sucrose (20 CaCO 3 (5 g/l) (pH before sterilization After 36 hours incubation at 25 250 rpm, the obtained culture was used to inoculate twenty volumes of complex production media containing: Corn steep solids (35 lactose (25 potassium phenylacetate .Io. (2.5 MgSO 4 .7H 2 0 (3 7,I 2
PO
4 (7 corn oil CaCO 3 (10 After continuation of the incubation 0 15 for another 48 hours, the mycelium was collected by S* filtration and the filter cake washed four times with cold o 0.15 M NaCl.
o 200 grams (wet weight) of mycelium were suspended in 700 ml of 0.05 M Tris-HCl buffer (pH 8) containing 5 mM dithiothreitol (hereinafter referred to as TD buffer) and disrupted in a Braun desintegrator (Braun, Melsungen, o using Ballotini glass beads (Sigmi type V, diameter aa°0 450-500 gm) for periods of 30 s at intervals of 15 s with refrigeration in an ethanol/dry ice bath. The extract was 25 then centrifuged for 30 min. at 20,000 x g. This and all following steps were carried out at 4 To 640 ml of the extract, 27 ml of a 10% w/v protamine sulphate solution in 4t” 0.05 M Tris-HCl pH 8 was slowly added. After stirring for minutes, the nucleic acid precipitate was removed by centrifugation at 20,000 x g and the supernatant fractionated by precipitation with ammonium sulfate while maintaining the pH of the solution at 8.0 during the ammonium sulfate additions. The fraction precipitating between 40% and 55% saturation was dissolve in TD buffer containing 1 M ammonium sulfate and applied to a phenylsepharose CL-4B column (1.8 x 16 cm) equilibrated with the same buffer. The column was washed with TD buffer at a ft Efficient transformation of Penicillium is provided to produce transformants having one or more structural genes capable of expression, particularly integrated into the host genome (integrants). DNA constructs 25 flow of 5 ml/min until no more unbound proteins were released.
Then the acyltransferase was eluted from the column with ethylene glycol in 0.05 M Tris-HCl pH The eluted fractions were assayed for acyltransferase activity by incubating at 25 °C in a reaction mixture containing 0.2 mM phenylacetylcoenzyme A, 0.2 mM 6-aminopenicillanic acid, 5 mM dithiothreitol, 0.1 M Tris-HCl pH and enzyme extract in a final volume of 200 Al. After minutes the reaction was stopped by adding 200 pl methanol.
The samples were centrifuged at 5000 x g and the penicillin G was assayed in the supernatant by conventional o, microbiological or chromatographic methods.
00 The active fractions from the phenylsepharose column 0° 0 15 were pooled and applied to a DEAE-Sephacel column (1.5 x cm) equilibrated with TD buffer and the acyltransferase activity was eluted with a linear (0 0.25 M) gradient of S’ NaC1 in TD buffer at a flow rate of 0.25 ml/min. The pooled active fractions were precipitated with 70% ammonium sulfate and the pellet dissolved in 3 ml of TD buffer and applied to a Sephadex G-75 (coarse) column (2.6 x 70 cm) equilibrated o° with TD buffer. The acyltransferase was eluted using TD o buffer at a flow of 9 ml/h and collected in the late part of the eluted fractions as a symmetrical peak of protein 0° 25 corresponding to acyltransferase activity. The final purification was 258-fold.
I 1 C i 26 EXAMPLE 4 Determination of the amino-terminal amino acid sequence of acytransferase and design of the corresponding oligonucleotide probe mixtures.
The enzyme preparation, obtained as described in Example 3 was run on an SDS-PAGE gel Laemmli, Nature, 227 (1970) pp. 680 ff) (13% acrylamide, 50 mA).
A 29 kD band (about 10 Ag of protein) was cut out of the SDS gel and the protein was electrophoretically transferred onto a PCGM-2 membrane (polybrene impregnated glassfic bre, Janssen, Beerse, Belgium), using a Multiphor II Nova blot unit (LKB; 0.8 mA/cm 2 90 min; electrode buffer 5 mM sodium borate pH After blotting, the PCGM membrane was washed four times with 25 mM NaCl, 10 mM sodium borate, pH 8.0 and air dried.
S” The PCGM adsorbed protein band thus obtained was analyzed t for N-terminal amino acid sequence, using a gasphase sequenator (Applied Biosystems model 470 The following sequence was determined: thr-thr-ala-tyr-cys-gln-leu-pro-asn-gly-ala-leu-ain- S. aglv-qln-asn-trp-asp According to the underlined part of this amino acid S 25 sequence, the following sets of oligodeoxyribonucleotides were synthesized:
T
I A C A T T 5′ CA GG CA AA TGGGA 3′ 30 G A G C C
G
The amino-terminal amino acid sequence of a 10 kD band sometimes present in the preparation was also determined, but not used for the construction of an oligodeoxyribonucleotide probe. The sequence obtained is: Met-Leu-His-Ile-Leu-X-Gln-Gly-Thr-Pro-Phe-Glu-Ile-Gly-Tyr- Glu-His-Gly-Ser-Ala-Ala-Lys-Ala-Val-Ile-Ala.
separately with both probes.
Moreover, after construction of a physical map of one genomic lambda clone, and hybridization of restriction digests of the lambda clone with separate probes for both I I -27 EXAMPLE Identification of the acyltransferase gene The DNA of a number of the lambda clones of Example 2 was digested with restriction endonuclease SalI, the fragments separated on a 0.7% agarose gel, transferred to Genescreen Plus and hybridized to the 32 P]-end labelled oligonucleotide mixtures of Example 4. The clones giving a positive signal were mapped by restriction analysis using standard methods. Two representative physical maps derived for the recombinant phages, lambda B21 and lambda G2, are shown in Figure 2. The oligodeoxyribonucleotide mixture hybridized specifically to the EcoRI/HindIII subfragment 15 indicated on the map. This and the adjacent fragments were recloned in pTZ 18/19 (United States Biochemical i Corporation) and subjected to nucleotide sequence analysis.
1 The determined sequence and the deduced amino acid sequence are shown in Figure 3.
The amino-terminal amino acid sequence of a 10 kD band also present in the preparation was determined and S*found to correspond to a DNA sequence upstream of the 29 kD S, sequence. Therefore, AT is probably synthesized as a 40 kD protein. This notion is confirmed by the length of the AT 25 messenger, which was demonstrated to be 1500 bases (similar to the isopenicillin N synthetase mRNA which encodes a 38 kD protein), thus allowing for 3′ and 5′ untranslated regions of 100 bases.
The amino acid sequences of the 29 kD (which has been extended to Thr-Thr-Ala-Tyr-Cys-Gln-Leu-Pro-Asp-Gly-Ala-Leu- Gln-Gly-Gln-Asn-Trp-Asp-Phe-Phe-Ser-Ala-Thr-Lys-Gln-Ala) and 10 kD proteins revealed the presence of two introns. A third intron is postulated on the basis of the gross amino acid composition of the 10 kD protein (97 residues) and on the consensus sequence for its boundaries Ballance, Yeast 2 (1986) pp. 229-236). The presence of this third intron was confirmed by primer extension and Northern blot The present invention is further exemplified by transforming Penicillium chrysogenum with genes that are specifically expressed under conditions where the antibiotic 1 28 hybridization using oligonucleotide probes from coding and non-coding regions.
EXAMPLE 6 Construction of pPS47 The phosphoglycerate kinase (pgk) gene was isolated from a Penicillium genomic library by standard methods (Maniatis; Example using the corresponding yeast gene (Hitzeman et al., vide supra) as a hybridization probe. The pgk promoter region is specified in part by the sequence shown in Figure 5, which is located directly upstream of the pgk coding region.
15 The P. chrysogenum pgk promoter was cloned into SpTZ18R as a 1.5 kb HindIII fragment and a clone having the t desired orientation was selected.
Subsequently, the phleomycin resistance gene was cloned into the BamHI site of the polylinker of this clone as a 1.0 kb BamHI plus BllII fragment, isolated from pUT702 (Cayla, Toulouse Cedex, France). The pgk promoter was fused in frame to the phleomycin resistance gene, by looping out the sequence to be deleted using an oligonucleotide with the sequence: ACG GCA CTG GTC AAC TTG GCC ATG GTG GGT AGT TAA TGG TAT G-3′ Moreover, this oligonucleotide introduces an NcoI site at the position of the ATG (underlined).
iii present invention provides the starting material for such a search for a mutant acyltransferase enzyme. E. coli is the best host for mutational cloning experiments; since E. coli lacks the splicing machinery for the removal of the introns 29 EXAMPLE 7 Construction of a transformation vector with a high transformation efficiency (pPS 54).
In order to obtain a transformation frequency of P. chrysoqenum that is sufficiently high to allow introduction of genes by transformation or cotransformation with the aim of complementing or amplifying non-selectable genes involved in p-lactam biosynthesis, it is desirable to include in the transformation vector a transformation- 0 0, enhancing sequence (cf. ans in Aspercillus, D.J. Ballance and G. Turner, Gene 36 (1985) pp. 321-331). Surprisingly, a 15 transformation-stimulating sequence which is functional in P. chrysoqenum is present on a DNA fragment containing the P. chrysoqenum Pyr G gene. Part of this 2.4 kb EcoRI S fragment is specified by the nucleotide sequence shown in Figure 4. This DNA fragment forms part of a 4 kb Sau3A partial fragment, cloned in the BamHI site of plasmid pUC 13 Messing, in Meth. Enzymol. 101 (Acad. Press, 1983) Sp. 20 This plasmid is referred to as pUC13::pyrG o hereinafter (see EP-A-260762 and Figure 6).
The 2.4 kb EcoRI fragment was included in a plasmid (pPS47) containing the phleomycin-resistance gene of Streptoalloteichus hindustanus under the control of the promoter of the phosphoglycerate kinase (pgk) gene from P. chrysogenum. The resulting construct is pPS 54.
The stimulatory effect of the PyrG fragment on the frequency of transformation is shown in Table 1 below: Table 1 plasmid transformants/Ag DNA pPS 47 (phleoR) 37 pPS 54 (DhleoR, yvrG) 186 ,f hwlA- x&’J I- -J designed and synthesized. These modifiations will result in modified characteristics of the enzymes, such as a change in pH or temperature optimum, a change in stability or a change in substrate specificity. Host strains, transformed with EXAMPLE 8 Biological and biochemical verification of the identity of the AT clones The identity of the AT clones was biologically verified by complementation of an acyltransferase-negative mutant of P. chrysoqenum Wis 54 1255, npe 8.
7 2 x 10 protoplasts of an uracil-requiring derivative of strain Wis 54-1255 npe 8 pyrG (CBS 512.88 deposited with Centraal Bureau voor Schimmelcultures on August 1988), as described in Australian Patent Application No. 39569/89, were cotransformed with a mixture of 5 pg of che oo 040 0 ao o a o 4 0 a *r e cc 0 £0 00
I•
c 0 s S 00I 6 1 t 29a 30 Biological and bioch ical verification of the identity/of the AT clones.
The identity of te AT clones was biologically verified by complemen tion of an acyltransferase-negative mutant of P. chrvso num Wis 54 1255, npe 8.
2 x 107 pr oplasts of an uracil-requiring derivative of strain Wis 5 -1255 npe 8, Wis 54 1255 npe 8 pvrG (CBS selective plasmid pUC 13:: pyrG and 15 pg of lambda B21 DNA o°o as described previously (EP-A-260762).
S:o Several hundreds of transformants were obtained, of S 15 which the conidia were collected and plated onto the complex production medium of Example 1 at a density of 1-10 colonies o” per petri dish. After 3 days incubation at 25*C, the plates oo were overlayered with a spore suspension of a penicillinsensitive Bacillus subtilis indicator strain and incubated overnight at 30°C to determine the size of the inhibition zones in the bacterial lawn.
D° 0 Most of the transformants showed very small o* haloes, similar in size to the penicillin non-producing recipient stain npe 8 pyrG. The remaining 25% showed large 25 inhibition zones comparable to those of the wild-type strain, Wis 54-1255. It was concluded that the former class had received only the selective plasmid pUC 13::EpyG, I whereas the latter had received both pUC 13:: pyrG and lambda B21, which restores penicillin productivity.
i 30 For several transformant clones from both groups, the level of AT-activity in cell-free extracts was determined as follows: Mycelia were collected after two days growth as described in Example 3, washed, frozen in liquid nitrogen and pulverized. For each assay, 2.5 grams of ground mycelium was suspended in 50 mM potassium phosphate buffer (pH containing 5 mM dithiothreitol and 5 mM EDTA (final volume 12.5 ml) and stirred for 25 minutes. The cell-free extract \QL 4- 31 was obtained by centrifugation of the suspension (5 minutes at 1000 x g).
AT-activity was assayed by incubating 2 ml of cellfree extract with 0.1 ml dithiothreitol (10 mg/ml), 0.2 ml 6-aminopenicillanic acid (10 mg/ml) and 0.2 ml phenylacetylcoenzyme A solution (20 mg/ml) at After 15 or 30 minutes, the reaction was stopped by adding an equal volume of methanol and the sample centrifuged (20 minutes at 5000 x The supernatant was then assayed for penicillin G formed by chromatographic (HPLC) methods known in the art. The results of a typical experiment are shown in Table 2 below, These data show that in transformed strains and the level of AT activity is increased 2-3 fold over that of the wild-type 15 consistent with the increased gene dosage.
The IPNS plus AT cluster was subcloned into pPS54, yielding pGJO1 A and B. A Sall fragment of 5 kb was made blunt by the action of T4 DNA polymerase and ligated into the unique HindIII site of pPS54, after treatment of this vector with T4 DNA polymerase.
t S P o o0 0 O O 0 400 0 006 e4 0 0 4 *4 4 0 a a 4* Table 2 STRAIN TRANSFORMED HALO: UNITS* PEN-G FORMED NUMBER OF WITH: PER MG PROTEIN, AT COPIES AS AFTER AFTER ESTIMATED BY 30 SOUTHERN minutes minutes HYBRIDIZATION Wis 54-1255 npe 8 yvrG pUC 13::yDrG passes test 0.9 i** idem pUC 13::yrG plus lambda 1.7 1.1 1** B21 idem idem 11.9 9.5 1 idem idem 10.8 7.0 1 Wis 54-1255 not transformed 4.5 2.7 1 U1 0 toa
ED
3 o Ort r
H-
r rt rt (D 0 m 0at rtrt0 PD g relative AT activity in extract.
inactive by mutation i; 33- EXAMPLE 9 Incre~a eL ^cilJ n__.inPrpduction in a host straoj transotned with the cryptic gene Y.
To show the effect of the genes identified herein as involved in penicillin production, the gene dosage of one of these genes was increased in a Penicillium host strain. To this end the gene contained in lambda clones B9, L5 and G5, was subcloned as a 3.0 kb BamHI plus SphI fragment into pPS47. The resulting construct, pRH05 was transformed to P.
chrvsoaenum Wis 54-1255 (ATCC 28089) and phleomycin o .resistant clones were isolated. Several clones were tested 99 S: for penicillin production in shake flasks.
i .0 15 The results obtained for one transformant isolated I 1 are shown in Table 3 below.
l* 41 1 d Table 3 strain relative production of penicillin Wis 54-1255 100 Wis 54-1255::pRH05 122 9u *a j 4 The increased gene dosage of gene Y in the 1 25 transformant, as compared to the untransformed host, was I confirmed by Southern blot analysis. Henca the increased I gene dosage of gene Y, a cryptic gene, isolated by the I method of the invention, results in a substantial increase in penicillin production.
The transcript size for gene Y has been determined by Northern blot hybridization: the transcript is about 1.0 kb long.

Claims (20)

1. A method for enhancing the production of a secondary metabolite in a bacterium or fungus host which produces said secondary metabolite, said method comprising: screening a DNA library prepared from a first host producing said secondary metabolite with probes obtained from mRNA or DNA derived therefrom from a second host of the same species lacking the production of said secondary metabolite; screening a genomic library of said first Lost with sequences which do not hybridize to said probes to identify fragments comprising genes transcribed in said first host which are not transcribed in said second host; preparing DNA constructs comprising said transcribed fragments and a marker for selection; transforming a candidate host capable of production of said secondary metabolite with said constructs and cloning the resulting transformants; and identifying clones producing said secondary metabol c a higher level than said candidate host.

2. A method according to claim 1, including the additional step of: S* screening transcription sequences of said first and second hosts with said fragments to determine the level of 25 transcription of said gene. .i 3. A method according to claim 1, wherein said first and t t “C t C second hosts are Peniillium, Aspergillus, Acremonium or ji Actinomycetes.

4. A vector comprising a gene encoding a protein c t involved in production of a B-lactarn antibiotic selected from the group consisting of an acyltransferase gene, cryptic gene Y ?nd a cryptic gene present on any of clones L12, K9, C12, P3, Kll, B13, B20, G3, Gl, L10, K16, and B23, a marker for selection in a host producing said B-lactam antibiotic and optionally a sequence for enhancing transformation efficiency of said vector in said host. A vector according to claim 4, selected from the 34 group consisting of pGJ01 A, pGJ01 B, and

6. A vector according to claim 4, wherein said B-lactam antibiotic is a penicillin.

7. A vector according to claim 6 selected from the group consisting of pGHO1 A, pGJ01B, and

8. A vector according to claim 4, wherein said gene comprises other than the endogenous promoter for transcription.

9. A transformed host comprising a vector according to any of claims 5, 6, 7, 8, or 4.

10. A transformed host capable of increased expression of a 8-lactam antibiotic selected from the group consisting of Penicillium, Aspergillus, Acremonium, and Actinomycetes, comprising as a result of transformation an extra copy of a sequence comprising a gene selected from the group consisting 20 of an acyltransferase gene, cryptic gene Y, and a cryptic gene present on any of clones L12, K9, C12, P3, Kll, B13, B20, G3, S Gl, L10, K16 and B23, and encoding a protei– involved in S production of a B-lactam antibiotic.

11. A transformed host according to claim 10, wherein said B-lactam antibiotic is penicillin.

12. A transformed host according to claim 10, wherein said gene is endogenous to said host.

13. A transformed host according to claim 12, wherein Ssaid B-lactam antibiotic is penicillin.

14. A transformed Penicillium host capable of increased expression of penicillin comprising as a result of transformation an extra copy Of a iuence comprising a gene selected from the group consisting of an acyltransferase gene, cryptic gene Y, and a cryptic gene present in any of clones K 12, K9, C12, P3, Kll, B13, B20, G3, GI, LI0, K16 and B23, and 35 encoding a protein involved in production of a penicillin. A transformed Penicillium host according to claim 14, wherein said host is the species Chrysoqenum.

16. A transformed Penicillium host according to claim 14, wherein said gene is under the transcriptional initiation regulation of other than the wild-type transcriptional initiation regulatory region.

17. A method for providing improved yields of a B-lactam antibiotic comprising: growing a transformed host comprising an extra copy of a sequence comprising a gene selected from the group consisting of an acyltransferase gene, cryptic gene Y, and a cryptic gene present on any of clones L12, K9, C12, P3, Kll, B13, B20, G3, Gl, L10, K16, and B23, encoding a protein involved in production of said 1-lactam antibiotic resulting in enhanced production of said B-lactam antibiotic. 20 18. A method according to claim 17, wherein said host is Penicillium, AsperQillus, Acremonium or Actinomycetes.

19. A method according to claim 18, wherein said host is Penicillium chrysoqenum. A gene encoding a protein involved in production of a secondary metabolite, said gene prepared according to a method comprising screening a DNA library prepared from a first host producing said secondary metabolite with probes obtained from mRNA or DNA derived therefrom from a second host of the same species lacking the production of said secondary metabolite; and screening a genomic library of said first host with sequences which do not hybridize to said probes to identify fragments comprising :’nes transcribed in said first host which are not transcribed in said second host.

21. A, DNA construct comprising a gene encoding a protein involved in the production of a secondary metabolite i f and a marker for selection in a host producing said S’ -36- secondary metabolite, said gene prepared according to a method comprising screening a DNA library prepared from a first host producing said secondary metabolite with probes obtained from mRNA or DNA therefrom from a second host of the same species lacking production of said secondary metabolite; and screening a genomic library of said first host with sequences which do not hybridize to said probes to identify fragments comprising genes transcribed in said first host which are not transcribed in said second host.

22. A transformed host and progeny thereof capable of production of a secondary metabolite, prepared according to a method comprising transforming a candidate host capable of production of said secondary metabolite with a DNA construct according to claim 21.

23. A method as claimed in any one of the claims as hereinbefore described with reference to any one of the examples. *.20 S 24. A vector as claimed in any one of the claims as hereinbefore described with reference to any one of the S examples. *It 5 25. A transformed host as claimed in any one of the claims as hereinbefore described with reference to any one of the examples.

26. A DNA construct as claimed in any one of the claim2 as hereinbefore described with reference to any one of the iexamples. DATED: 14 September 1992 PHILLIPS ORMONDE FITZPATRICK Attorneys for: GIST-BROCADES N.V. 37 S a e~ a S a a a a a a a -e a a L-ot-aminoadipic acid L -cystel ne L -val ine ACV- SY NrHETAS E (ACVS) -a(-amI noadi pyl)-L -cystel nyl val I ne ISOPENICILLIN N SYNTI-ETASE (IPNS; cyclase) 1< :1 (D rt 0 0Ot 02 0Ch mN N) W< aA x (D En (A M-. 0) zrt, 0 o a z 0 CD '0 :3 0 In 0 (no o ri D 00 t"11 E n CD) i 0 ACYL-CrA:IPN .ZCY LT R A N S F E R AS E L (AT)- isopenicillin N (LPN) 6-arninopenicillcIonic acid ,7(6-A PA) phenoxyacelic acid FIG. 1 pe-tlcillin-G or V I I' I' I, iiL (I ii $1 ii ,1 ~i1 I I1 H XSP HE X1 S 1 LIIS 1kb H S B S BES Bi H' E S SSB EE HS I '5 I L" II I I1 G2 IPNS AT S S BES B H E S SB EE HH S I III I I' II 11I B21 Sp lPNS AT SKSPSaB B PHS Sa ESp E S E H E _T H E S H I -II4I I L T B9 H SB HS E E B ES EH EH H E S SE HEH HS B B HS E E B ES EH S H EmmaI I I III I s SH(B) BSE(H)(H' Y BBP BSEH L12 S(B) S H B S B S B H S S B HH S I 1 1~ I_ I I I H HS jt5~7 :.K9 rwmrwr s (EE)E EH ESHEFH H E S B E S H 012 :m SB s E SBEH S HHSBHE S EH EB P3 S B H E.-3 E H EB B BES S E ES K11 K 161 .SB BES H BH ESBSSEBEP. *LCB 13 SB S B (S)S B S B tt I I S H~ S(820 f Awwx~aaxP~e Z SB S EHE E BE H BS S H S E B SB S(EE)S B B S (E)B(E 3 E)SS B H K16 S) s H S E E B EHSH B HHES H B23 EBB FIG. 2 ;i pPS 47 (phleoR) pPS 54 (phleoR, pyrG) 37 186 20 30 40 so AAGCTTTCAGGCAACCTAGGCAACCCAATAGGAACCAAGTGATAGGCCCACCITGCTITT 80 90 100 110 120 ATCTAGTCTGGACGGTTGCTATTGGCTCG ATCATTGTTTACCATCCCGGCAAAAAGCTCT 130 140 150 160 170 AC AGAGTTGTGCTATTTCTATTCCTGT'CTTGGCATGTCCA GGCTGGCTGTTATCGCCTCC 190 200 210 220 230 240 GTGGTGAACCCTCTTCATGCAAGAGGTCAGTCAATAATGCGCTTCACCGTTCTCGACGAA 000250 260 270 280 290 3 (J 00ACTTGGCATCCATGCTCAATCCAGCTCCTCGGCAAGACTAGGCGGATGCAGCAGGGATAC 00a 310 320 330 340 350 360 TCGAGG TGCCCCAGTTGATGTCCCATCAGTGTCATGCTATGGTCCCAG ATTGGTGGCTAC, 370 380 390 400 410 420 GGCCAATATAAATCTCAGCATGCAGTTCCGCCTGCATGATCATCCCCAGGACGCGTTTGT C:430 440 450 460 470 480 4t4 CATCTCCGTCAGCCAGGTCTCAGTTGTTTACCCATCTTCCGACCCGCAGCAGAAATGCTT t t 4 Pet Leu 490 500 510 520 5 10 540 CACATCCTCTGTCAAGGCACTCCCTTTGAAGTAAGTGCTGCACI'GAATACCAGATTTTTI' HislIeLeuCysGlnGlyThrProPheGlu 550 560 570 580 590 600 CCTTCTGAATCTTCCGAGTTCTGACCTGATCCAGATCGGCTACGA ACATGGCTCTGCTGC IleGlyTyrGluHisGlygerAla.1l1 610 620 630 640 650 660 CAAAGCCGTGATAGCCAGAAGCATTGACTTCGCCGTCGATCTCAT(CCGAGGGAAAACGA A aLy~sAlaVallleAlaArgSerlleAspPheAlaValAspLeujleArgGlyLysThrLy 670 680 690 700 710 720 GAAGACGGACGAAGAGCTTAAACAGGTACTCTCGCAACTGGGGCGCGTGATCGAGGAAAG sLysThrAspGluGluLeuLysGlnValLeuSerGlnLeuGlyArgVal leGluGluAr 730 740 750 760 770 780 ATGGCCCAAATACTACGAGGAGATTCGCGGTGAGTGCCACTTCGG' CTTTCCTACATTTT gTrpProLysTyrTyrGluGlul IeArgG FIG. 3A 29a 790 800 810 820 830 84.0 CTGCACCAATGCTGAGCGATGACCCCCGAAAAACCAGGTATTGCAAAGGGCGCTGAACGC IyIleAlaLysGIyAlaGluArg 850 860 870 880 890 900 GA TGTCTCCGAGATTGTCATGCTTAATACCCGCACGGAATTTGCATACGGGCTCAAGGCA AspValSerGlul leValMetLeuAsnThrArgThrGluPheA IaTyrGlyLeuLx'sAla I 910 920 930 940 950 960 GCCCGTGATGGCTGCACCACTGCCTATTGTrCAACTTrCCAAATGGAGCCCTCCAGGGCCAA :1 AlaArgAspG1YvCysThrThrAlaTyrCysGl~nLeuProAsnGlyAlaLeuGnGl 3 .G~n 970 980 990 1000 1010 1020 AACTGGGATGTACGTTAAGAGATTTTACCTCCTCATTTTAITTCCATCGAATTTGCGCCGA AsnTrpAsp 1030 1040 1050 1060 1070 1080 CTAATTTGGTTGTTCAAGTTCTTTTCTrGCCACCAAAGAGAACCTGATCCGGTTAACGATC PhePheSerAlaThrLysGluAsnLeulleArgLeuThrl le 1090 1100 1110 1120 1130 1140 CGTCAGGCCGGACTTCCCACCATCAAATTCATAACCGAGGCTGGAATCATCGGGAAGGTT ArgGinAlaGlyLeuProThrx~eLysPhelleThrGluAlaGlyllelleGlyLysyaI 1150 1160 1170 1180 1190 1200 V GCATTTAACAGTGCGGGGGTCGCCGTCAATTACAACGCCCTTCACCTTCAGGGTCTTCGA GlyPheAsnSerAlaGlyValAlaValAsnTyrAsnAlaLeuHisLeuGlnGlyLeuArg 1210 1220 1230 1240 1250 1260 CCCACCGGAGTTCCTTCGCATATTGCCCTCCGCATAGCGCTCGAAAGCACTTCTCCTTCC 11 ProThrGlyValProSerHisl eAlaLeuArgIleAlaLeuGluSerThrSerPr-oSer ':1270 1280 1290 1300 1310 1320 t CAGGCCTAATGACCGGATCGTGGAGCA AGGCGGAATGGCCGCCAGCGCTTTTATCATGGTG GinA] aryrAspArgi leValGluGlnGlyGlyMetAlaAlaSerAlaPhel leMet~aI 1330 1340 1350 1360 1370 1380 GGCAATGGGCACGAGGCATTTGGTTTGGAATTCTCCCCCACCAGCATCCGAAAGCAGGTG GlyAsnGl yHisGIuAlaPheGlyLeuGluPheSerProThrSer[ leArgLysGl nVal 1390 1400 1410 1420 1430 1440 CTCGACGCGAATGGTAGGATGGTGCACACCAACCACTGCT'rocrTCAGCACGGCAAAAAI' l~us~as~yr~ta~sh~s~sy~ueGni~y ss A1450 1460 1470 1480 1490 1500 GAGAAAGAGCTCGATCCCTTACCGGACTCATGGAATCGCCACCAGCGTATGGAGTTCCTC GluLysGluLeuAspProLeuProAspSerTrpAsnArgHisG lnArgfletGluPheLeu 1510 1520 1530 1540 1550 1560 CTCGACGGGTTCGACGGCACCAAACAGGCATTTGCCCAGCTCTGGGCCGACGAAGACAAT LeuAspGlyPheAspGlyThrLysGlnAlaPheAlaGlnLeuTrpAlaAspGluAspAsn 1570 1580 1590 1600 1610 1620 TATCCCTTTAGCATCTGCCGCGCTTACGAGGAGGGCAAGAGCAGAGGCGCGACTCTGTTC TyrProPheSerileCysArgAlaTyrGluGluGlylysSerArgGlyAlaThrLeuPhe FIG. 3B was suspended in 50 mM potassium phosphate buffer (pH containing 5 mM dithiothreitol and 5 mM EDTA (final volume. 12.5 ml) and stirred tor 25 minutes. The cell-free extract 1630 1640 1650 1660 1670 1680 AATATCATCTACGACCATGCCCGTACAGAGGCAACGGTGCGGCTTGGCCGGCCGACCAAC A sn IIe I jeTy rAs PH is A IaA rgA rgG IuA Ia ThV a IA rg L e uG1yA rg P roT h rA sn 1690 1700 1710 1720 1730 1740 ICCTGA TG AGATGTTTGTCATGCGGTTTG ACG AGGAGGACG AG AGGTCTGCGCTCA ACGCC ProAspGlu~etPheValMetArgPheAspGluGIuAspGluArgSerAlaLeuAsnAla 41750 1760 1770 1780 1790 1800 A GGCTTTGAAGGCTCTTCATG ACGAGCCAATGCATCTTTTGTATGTAGCTTC AAC CGCACT ArgLeuEnd 1810 1820 1830 1840 1850 1860 CCGTCTTCACTTCTTCGCCCGCACTGCCTACCGTTTGTACCATCTGACTCATATAAATGT 1870 1880 1890 1900 1910 1920 CTAG CCCCTACCTACACTATACCTAAGGGAGAGAAGCGTAGAGTGATTAACGTACGGGCC 0*01930 1940 1950 1960 1970 1980 TATA GTACCCCGATCTCTAG ATAGAACATTTAGTAGAGATTAGGA TGCCTAACTrAA TTTA *,1990 2000 2010 2020 2030 2040 ACTTGAGCATTGTCCCGTTCATATTGATTTTCAGTCCATTATACACTCTTAATCGTTTCC (42050 2060 2070 2080 2090 2100 CGGTAGAAGCCTGATATATACGACCATAGGGTGTGGAGAACAGGGCTTCCCGTCTGCTTrG GCCGTACTTAAGCTATATATTCTACACGGCCAA 214021502160GACCAAG 2170 2180 2190 2200 2210 2;22 0 GGCACTCTAGGGTAAGTGCGGGTGATATAGGTGAGAAGTCTTAAGACTGAAGACAGGA TA 2230 2240 2250 2260 2270 2280 TCACGCGTTACCCTGCACCGTACCTACTACCTTCAATATCAACTCTTTCAGGATOGACAG GGTCGAC FIG. 20 30 40 s0 AAGCTTGAATCTCTATGTCTGATGAGACTATGTA~TGTATATCAACTGCAACGT'ATCCGT 90 100 110 120 ATATGCGCACACGTTCGAAGGTCAAGGCCGTGGGGTCCACTGTGGCAGAAAAGTCCCGAT 130 140 150 160 170 180 TGTCTTCGATTCGAACTTGCTGCTATTATTCTACTTTGGACGTCAAGAAGGCAATTACAA if190 200 210 220 230 240 TCATATCCTAGAAGGATTTGTCATTTGATTCACTTCCCTCTTAAAATCTCAAAATCACAT 250 260 270 280 290 300 ACCCAATACATTACCATCTCTTCACCCCGCCAACCCCGCCATGTCCTCCAAGTCGCAATT IletSerSerLysSerG inLe *0 310 320 330 340 350 360 GACCTACACGGCCCGCGCCCAATCGCACCCCAATCCCCTCGCGCGCAAGCTATTCCAAGT uThrTyrmhrAlaArgAlaGlnSerHsProAsnProLeuAlaArgLysLeuPheGlflVa 370 380 390 400 410 420 CGCCGAAGAGAAGAAGAGCAATGTTACTGTCTCCGCTGACGTGACCACAACAAAGGAGCT lAlaGluGluLysLysSerAsnValThrValSerAlaAspValThrThrThrLysGluLe 430 440 450 460 470 480 4 CCTGGACCTCGCCGACCGTAAGTGAACCCAGCTCCCCCCACTCCAAAGGAACAAGCCACT uLeuAspLeuAlaAspA 0490 500 510 520 530 540 AACCATCCACAGGCCTTGGCCCCTACATCGCCGTGATTAAAACACACATCGACATCCTCT r&LeuGlyProTyrl leAlaVal~leLysThrHlsIleAspIeLeuS 550 560 570 580 590 600 CCGACTTCAGCCAAGAAACAATCGATGGCCTGAACGCCCTAGCGCAAAAGCACAACTTCC erAspPheSerGlnGluThrl leAspGlyLeuAsnAlaLeuAlaGlnLysHisAsnPheL r610 620 630 640 650 660 ITATCTTCGAAGACCGCAAATTCATCGACATCGGCAACACAGTCCAGAAACAGTACCACA eul lePhe~luAspArgLysPbel leAspI leGlyAsnThrValGlnLysGlnTyrHisA 670 680 690 700 710 720 ATGGCACCCTCCGCATCTCCGAATGGGCGCACATAATCAACTGCTCCATCCTACCCGGCG snGlyThrLeuArglleSerGluTrpAlaHislIlleAsnCysSerIleLeuProGlyG 730 740 750 760 770 780 AGGGCATTGTCGAGGCCCTCGCTCAAACCGCCCAGGCCACTGATTTCCCCTACGGCTCCG luGlylleValGluAlaLeuAlaGlnThrAiaGlnAlaThrAspPheProTyrGlySerG FIG. 4A -N m RT U' 4 9* 99 9 9 4* 4e40 4 44 9 *94 49,4 4 4 4* 4 99 94 o 4 9 790 800 810 820 830 840 AGCGTGGCCTCCTCATCCTCGCCGAGATGACCTCGAAGGGATCCCTCGCAACAGGCGCCT luArgGlyLeuLeul leLeuAlaGluMetThrSerLysGlySerLeuAlaTbrGlyAlaT 850 860 870 880 890 900 ACACCTCCGCCTCCGTCGACATCGCGCGCAAGTACCCCAGCTTCGTGCTTGGCTTTGTCT yrThrSerAlaSerValAspl lAlaArgLysTyrProSerPheValLeuGlyPheVaIS 910 920 930 940 950 960 CCACCCGGTCTCTCGGCGAGGTCGAGTCTACAGAGGCGCCCGCGAGCGAGGATTTCGTCG erThrArgSerLeuGlyGluVaIGluSerThrGluAlaProAlaSerGluAspPheVal V 970 980 990 1000 1010 1020 TCTTCACCACTGGCGTCAACCTCTCGTCTAAGGGCGATAAGCTCGGTCAGCAGTACCAGA al PheThrmhrGlyValAsnLeuSerSerLysGlyAspLysLeuGlyGlnGlnTyrGlnT 1030 1040 1050 1060 1070 1080 CGCCGCAGTCGGCTGTTGGCCGCGGTGCTGACTTTATTATCTCTGGT1CGTGGTATCTATG hrProGInSerAlaValGlyArgGlyAlaAspPheIlelleSerGlyArgGlylleTyrA 1090 1100 1110 1120 1130 1140 CCGCTGCCGATCCTGTTGAGGCCGCTAAGCAGTACCAGCAGCAGGGCTGGGAGGCGTATC laAlaAlaAspProValGluAlaAl-aLysGlnTyrGlnGlnGlnGlyTrpGluAlaTyrL 1150 1160 1170 1180 1190 1200 TGGCCCGCGTGGGTrGCGCAATAGGAGCGTGCGTCCACCTTCCACTATAGGTACATTTGTG euAlaArgValGlyAlaGlnEnd 1210 1220 1230 1240 1250 1260 TTGATGCATAATGAGAATTCTATATACGATGTCGTGCTATAACCTTTTGCAGTTTGGTGC 1270 1280 1290 1300 1310 1320 TTCCTTACATCACCGGTGTTCACGACCTCGGOACCTCGGGACCTCCCGATGCCTTTCCAG 1330 1340 1350 1360 1370 1380 GGCCATGTAAGGGCTTTCTGGCATGTACAGACGGTGCAAGGGCAAGGTTGAGTCAACATA 1390 1400 CATGCAAGTGCTCAGCGGCATGT FIG. 4B *4.4 4 44 99 4 *4 4 4 9 49 9 .4 44 4 49 44.4449 4 4 444t*t 4 4 20 30 40 50 CTATGAATTCCCATCAGTAGAGGCCAATTCCCGAGAATTTCCCGATTCCGAGGCTAAAGA 80 90 100 110 120 GGCTAAAGAGGACCTCCATGGCCCGGCCTTCCCCGTATCAACGCGGGCAGCTCTGACATC 4130 140 150 160 170 180 AGTCCCGCGTCAGCCCGATCAGTTCTCCGGGATACTCGGTACGGCGTCTGAGGTACTGCT 190 200 210 220 230 240 TTTATAGATATACCTAGGAAAAGAGGGATTGCATCATACTTCGAGCAAGTACCTTATTCC 250 260 270- 280 290 300 *0 GTCGAATACATCATCGGGAGGTACCTGGGTTGCTACGGTTGCGACCTCTTCACCGGCCTG 00310 320 330 340 350 360 *OO#CCCCACCAAAACTGACCCCTCCACI'CTTTACTGATCGCGACTCACCGTGGCCTGATTAGT 370 380 390 AOO 410 420 TCTTTCTCCTTCTTCTATCCCTTTTCTGCTCCr7TCACCATTGTCATACCATTAACTAC t CCACA FIG. 9,91U EpAd EudwV 11 3H i 11 1 3 SH H I I F S 3H 00 0 0 pTZ 18R H S 900 40 0 0 0 0 4 0 0 o 0 0 00 00 a o 04 0 0 0 0 0 000 6 0£ 0 o 4. 0 0 KN E E I I I AmrpR pPGK phleoR pyrG 1kb FIG. 7 p I I Sp KN Sp pTZ 18R AmpR pPGK phleoR NY" 1 k:j FIG. 8 host which are not transcribed in said second host. 21. DNA construct comprising a gene encoding a protein involved in the production of a secondary metabolite ,and a marker for selection in a host producing said 36- 1< £0D L IL U 0 0 W CO if 0 9 z z C) t- t 1 c }o o I C? 0. 0 I Ii ao I 1| Z -0 m -I- 2, I ,0 j 0. wO w I 1 i, N o Ial Ihl PHILLIPS ORMONDE FITZPATRICK Attorneys for: GIST-BROCADES N .V. Jv 37 wi 0) 0 0. 6I t I E I I I II t t I I III I ti ~c II IC LL CE E wi U AU39568/89A 1988-08-11 1989-08-11 A method for identifying and using biosynthetic or regulatory genes for enhanced production of secondary metabolites Ceased AU631371C (en) Applications Claiming Priority (6) Application Number Priority Date Filing Date Title EP88201714 1988-08-11 EP88201714 1988-08-11 EP88202118 1988-09-28 EP88202118 1988-09-28 EP89200522 1989-03-03 EP89200522 1989-03-03 Publications (3) Publication Number Publication Date AU3956889A AU3956889A (en) 1990-02-15 AU631371B2 true AU631371B2 (en) 1992-11-26 AU631371C AU631371C (en) 1995-01-27 Family ID= Also Published As Publication number Publication date DK393189D0 (en) 1989-08-10 FI893723A0 (en) 1989-08-07 EP0354624A2 (en) 1990-02-14 DK393189A (en) 1990-02-12 FI104984B (en) 2000-05-15 CA1340900C (en) 2000-02-15 FI893723A (en) 1990-02-12 EP0354624A3 (en) 1990-04-25 AU3956889A (en) 1990-02-15 JPH02167078A (en) 1990-06-27 KR900003363A (en) 1990-03-26 JP2954601B2 (en) 1999-09-27 Similar Documents Publication Publication Date Title US5462862A (en) 1995-10-31 Method and compositions for enhancing production of secondary metabolites using clustered biosynthetic genes Kennedy et al. 1996 δ-(L-α-Aminoadipyl)-L-cysteinyl-D-valine synthetase is a rate limiting enzyme for penicillin production in Aspergillus nidulans KR100336174B1 (en) 2002-11-01 Efficient method for preparing 7-ADCA via 2- (carboxyethylthio) acetyl-7-ADCA and 3- (carboxymethylthio) propionyl-7-ADCA JP2010075204A (en) 2010-04-08 Gene conversion as tool for constructing recombinant industrial organism KR100327881B1 (en) 2002-07-02 Efficient way to prepare 7-ADCA via 3- (carboxyethylthio) propionyl-7-ADCA US5108918A (en) 1992-04-28 Method for identifying and using biosynthetic genes for enhanced production of secondary metabolites CA1340900C (en) 2000-02-15 Method for indentifying and using biosynthetic or regulatory genes for enhanced production of secondary metabolites Díez et al. 1989 Two genes involved in penicillin biosynthesis are linked in a 5.1 kb Sal I fragment in the genome of Penicillium chrysogenum EP0320272B1 (en) 1995-05-17 DNA encoding ACV synthetase JP2000509613A (en) 2000-08-02 Promoters for the genes glutamate dehydrogenase, β-N-acetylhexosaminidase and γ-actin and their use in filamentous fungal expression, secretion and antisense systems Banuelos et al. 2000 Overexpression of the lys1 gene in Penicillium chrysogenum: homocitrate synthase levels, α-aminoadipic acid pool and penicillin production US5747285A (en) 1998-05-05 DNA comprising regulatory regions from gene y of penicillium chrysogenum EP0922766A1 (en) 1999-06-16 Process for the inactivation of genes which code for enzymes for the catabolism of phenyl acetate, plasmids involved in such process and strains transformed therewith US5882879A (en) 1999-03-16 Method for influencing β-lactam antibiotic production and for isolation of large quantities of ACV synthetase US6258555B1 (en) 2001-07-10 DNA encoding ACV synthetase EP0444758A1 (en) 1991-09-04 Method for modification of ACV synthetase and use of the modified enzyme for production of beta-lactam antibiotics HU209941B (en) 1994-12-28 Method for identifying and using biosynthetic or regulatory genes for enhanced production of beta-lactam antibiotics, these comprising vector, and transformation of fungi cells WO2005040369A1 (en) 2005-05-06 Process for producing penicillin EP0716698B1 (en) 2004-09-22 Process for the efficient production of 7-ADCA via 2-(carboxyethylthio)acetyl-7-ADCA and 3-(carboxymethylthio)propionyl-7-ADCA KR19990028533A (en) 1999-04-15 Phenylacetyl-CoA Ligase from Penicillium Chrysogenum Whitehead 1991 Development of homologous transformation systems for the filamentous fungi'Cephalosporium acremonium'and'Penicillium chrysogenum' WO1992017496A1 (en) 1992-10-15 Isolation and sequence of the acetyl coa:deacetylcephalosporin acetyltransferase gene PT91410B (en) 1995-09-12 PROCESS FOR IDENTIFYING AND USING BIOSAETIC OR REGULATING GENES FOR THE ENHANCED PRODUCTION OF SECONDARY METABOLITES Legal Events Date Code Title Description 2004-04-08 PC Assignment registered Owner name: DSM IP ASSETS B.V. Free format text: FORMER OWNER WAS: DSM N.V.
Download PDF in English